ID: 1170939776

View in Genome Browser
Species Human (GRCh38)
Location 20:20839343-20839365
Sequence ATGTTTTCAAGAGAAAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170939776_1170939782 9 Left 1170939776 20:20839343-20839365 CCTAACTTTTCTCTTGAAAACAT No data
Right 1170939782 20:20839375-20839397 GCACAGATAGAGCTTGGGATGGG No data
1170939776_1170939780 4 Left 1170939776 20:20839343-20839365 CCTAACTTTTCTCTTGAAAACAT No data
Right 1170939780 20:20839370-20839392 TGGATGCACAGATAGAGCTTGGG No data
1170939776_1170939779 3 Left 1170939776 20:20839343-20839365 CCTAACTTTTCTCTTGAAAACAT No data
Right 1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG No data
1170939776_1170939781 8 Left 1170939776 20:20839343-20839365 CCTAACTTTTCTCTTGAAAACAT No data
Right 1170939781 20:20839374-20839396 TGCACAGATAGAGCTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170939776 Original CRISPR ATGTTTTCAAGAGAAAAGTT AGG (reversed) Intergenic
No off target data available for this crispr