ID: 1170939779

View in Genome Browser
Species Human (GRCh38)
Location 20:20839369-20839391
Sequence CTGGATGCACAGATAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170939776_1170939779 3 Left 1170939776 20:20839343-20839365 CCTAACTTTTCTCTTGAAAACAT No data
Right 1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG No data
1170939775_1170939779 14 Left 1170939775 20:20839332-20839354 CCATCACAACTCCTAACTTTTCT No data
Right 1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170939779 Original CRISPR CTGGATGCACAGATAGAGCT TGG Intergenic
No off target data available for this crispr