ID: 1170941827

View in Genome Browser
Species Human (GRCh38)
Location 20:20854368-20854390
Sequence CCACAGGAAGTATGGGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170941817_1170941827 13 Left 1170941817 20:20854332-20854354 CCTGTGCCCTTCTTGGCATTCAG 0: 1
1: 1
2: 1
3: 11
4: 202
Right 1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 189
1170941819_1170941827 6 Left 1170941819 20:20854339-20854361 CCTTCTTGGCATTCAGAAATTCC 0: 1
1: 0
2: 2
3: 28
4: 225
Right 1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 189
1170941818_1170941827 7 Left 1170941818 20:20854338-20854360 CCCTTCTTGGCATTCAGAAATTC 0: 1
1: 2
2: 3
3: 51
4: 443
Right 1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170941827 Original CRISPR CCACAGGAAGTATGGGCAAG GGG Intergenic
901632623 1:10655406-10655428 CCACACCAAGTATGGCCATGGGG + Intronic
903735392 1:25527015-25527037 CCACAGCAAGTAGGTGGAAGAGG - Intergenic
903742787 1:25567887-25567909 TCCCAGGAAGTATGGGGAGGCGG - Exonic
905623418 1:39469078-39469100 CCACAGGAATTACAGGCAAAGGG - Intronic
906024001 1:42657686-42657708 GCACAGTAACTAAGGGCAAGTGG + Intergenic
907340472 1:53731768-53731790 ACACAGAAAGAATGGGGAAGAGG - Intronic
908527541 1:65002371-65002393 CCAAGGGAAGTATGAGCTAGTGG + Intergenic
910430761 1:87157431-87157453 CCACAGGAAATAAGGTCCAGTGG + Intronic
911432511 1:97809915-97809937 CTACAGGAAGGATGGGTAACAGG + Intronic
915142466 1:153776021-153776043 CCACAGAAACTCTGGGCCAGCGG - Exonic
917472368 1:175336737-175336759 CCCCAGGAAGAATGGGGAAGGGG + Intronic
921512504 1:216049787-216049809 CCCTAGGAACTAAGGGCAAGTGG - Intronic
922388125 1:225108726-225108748 CCACAGGAAAAATGGACAAATGG - Intronic
924598847 1:245470353-245470375 ACAAAGGAAGAATTGGCAAGGGG + Intronic
1065315573 10:24460417-24460439 ACCCAGGAAGAATGGGCATGAGG + Intronic
1067268404 10:44767446-44767468 CCCCTGGAAATATGGGCGAGTGG - Intergenic
1069602074 10:69714400-69714422 CCAGAGGAAGTTTGGGTTAGAGG + Intergenic
1070183254 10:74034977-74034999 CCACAGTAAGTACAGGCAAATGG + Intronic
1070732621 10:78841816-78841838 CCACAGAAAGGTTGGGGAAGAGG + Intergenic
1071810461 10:89175445-89175467 CTACAAAAAGTATGGGCATGGGG + Intergenic
1074447859 10:113534988-113535010 CCACAGGAAGCAAAGGGAAGGGG + Intergenic
1074495633 10:113977928-113977950 CCAGAGAAAGGATGGGAAAGGGG - Intergenic
1074925740 10:118068559-118068581 CCACAGCAAATAGGGGGAAGGGG - Intergenic
1074957469 10:118406357-118406379 CCACAGAAAGAAAGGGCTAGAGG - Intergenic
1075056409 10:119222187-119222209 CCACAGGAAACAAGGGGAAGTGG - Intronic
1075280261 10:121132852-121132874 CCAAAGGCAGTAGGGACAAGAGG + Intergenic
1075353182 10:121744780-121744802 CCACAGGAAGGCTGGGAAACAGG - Intronic
1076208845 10:128624846-128624868 CCAGAGAAAGTGTGGGCGAGGGG - Intergenic
1076760932 10:132605409-132605431 CCCCAGGAGGGATGGGAAAGGGG + Intronic
1083967633 11:66052308-66052330 CCACCGGAAGTTCCGGCAAGTGG + Intronic
1088973659 11:114795549-114795571 CCAAAGCAAGGATGGGCAACAGG - Intergenic
1089732815 11:120529986-120530008 CACCAGGAAGGAAGGGCAAGTGG - Intronic
1089787949 11:120921567-120921589 TCACAGGAAGTGCGCGCAAGCGG - Intronic
1090065802 11:123502413-123502435 CCACCGGATTAATGGGCAAGGGG - Intergenic
1090179037 11:124677807-124677829 CAACAGAAAATATTGGCAAGAGG + Intronic
1090634580 11:128682749-128682771 TCACAGGAAGAATGGGAAATAGG + Intergenic
1093866340 12:24231479-24231501 CAAAAGGAAGTATAGGCTAGAGG + Intergenic
1093928272 12:24930166-24930188 CCACAGGAGGTGAGGACAAGGGG - Intronic
1094284961 12:28782525-28782547 ACACAGGAAGAATGGGAGAGAGG + Intergenic
1095968305 12:47883952-47883974 CCACAAGAAGCATGGGCAGTGGG + Intronic
1096579636 12:52576327-52576349 CCACAGCAAGGATGGGCAGGGGG + Intergenic
1097482979 12:60154625-60154647 CCACAGTAAATCTTGGCAAGTGG - Intergenic
1101190543 12:102327966-102327988 CCACAGGAATTATAGTCTAGTGG + Intergenic
1101558763 12:105835668-105835690 CTACAGGAAGTGTGGACAACTGG + Intergenic
1102628876 12:114259174-114259196 TCATGGGAAGTATGGGGAAGAGG + Intergenic
1105699549 13:22926265-22926287 GAACAGGAAGTATTGGCGAGAGG + Intergenic
1106478886 13:30121865-30121887 CCACAGGAAGCAAGGGCACCAGG + Intergenic
1109957009 13:69581705-69581727 GCACAGGGATCATGGGCAAGAGG - Intergenic
1110557774 13:76879594-76879616 CCAGAGGAAGTACAGGCAAAAGG + Intergenic
1111458151 13:88509956-88509978 TCACAGGAAGTATGGGCCCATGG + Intergenic
1111985888 13:95066745-95066767 CCATCGGCAGAATGGGCAAGAGG - Intronic
1112284969 13:98096193-98096215 CCACAGGAAGAAGGGTCAAAGGG - Intergenic
1114592475 14:23879586-23879608 CCAAAGTAAGAATGGGCAAACGG + Intergenic
1117910454 14:60633128-60633150 CCAAAGGAAGTATGGTAATGAGG - Intergenic
1119861810 14:77941427-77941449 CTACAGGAAGAAAGAGCAAGGGG - Intergenic
1121643469 14:95501706-95501728 CCACAGGAGGGAAGGGCATGGGG + Intergenic
1122218161 14:100218049-100218071 CTCCTGGAAGCATGGGCAAGCGG - Intergenic
1125716141 15:41821020-41821042 TCCCAGGAAGCATGGGCAGGAGG + Exonic
1126258219 15:46653487-46653509 CAACAGCAAGTGTGGGCATGTGG + Intergenic
1129035149 15:72644576-72644598 GCACAGGAAGTATGAGCTGGGGG - Intergenic
1129214733 15:74092640-74092662 GCACAGGAAGTATGAGCTGGGGG + Intergenic
1129324746 15:74794122-74794144 CCACAGGAGGCAGGGGCAAGGGG + Intronic
1129324763 15:74794177-74794199 CCACAGGAGGCAGGGGCAAGGGG + Intronic
1129324782 15:74794232-74794254 CCACAGGAGGCAGGGGCAAGGGG + Intronic
1129324803 15:74794287-74794309 CCACAGGAGGCAGGGGTAAGGGG + Intronic
1129324824 15:74794342-74794364 CCACAGGAGGCAGGGGCAAGGGG + Intronic
1130936466 15:88475144-88475166 CCACAGGAAGCAAAGGCAAGGGG - Exonic
1134248519 16:12557943-12557965 CCACAGGAAGACAGGGCAAGCGG - Intronic
1137784912 16:51130516-51130538 CCACATGTAGTAAGGGTAAGTGG - Intergenic
1137952714 16:52798911-52798933 CCAAAGGAAGTGTGGGTATGAGG - Intergenic
1137957973 16:52852482-52852504 CCATAGGTAGCATGGGCAGGTGG + Intergenic
1138382129 16:56609868-56609890 CCACAGGGAGTTTGGGAAACCGG - Intergenic
1140410220 16:74736695-74736717 CCTGAGGAAGGATGGGGAAGAGG + Intronic
1141506562 16:84482104-84482126 GCACAGGAAGCAGGGGGAAGCGG - Intronic
1143091602 17:4452385-4452407 CCACAGGAAGGATGTACAAGGGG + Intronic
1143451742 17:7040851-7040873 CCACAGGGATAATGGGGAAGAGG - Intergenic
1144126491 17:12207460-12207482 CCACAGGAACTCTGGGTAGGTGG + Intergenic
1144364210 17:14526367-14526389 CCAAAGGCAGTTTGGGAAAGGGG - Intergenic
1145126555 17:20304894-20304916 CAACAGTCAGAATGGGCAAGAGG + Intronic
1146831825 17:36076127-36076149 CCCCTGGATGTGTGGGCAAGAGG + Intergenic
1147358783 17:39918336-39918358 CCAAAGGTAGGATGGGGAAGTGG - Intronic
1152791606 17:82283189-82283211 CCACTGGAGGTGTGGGCAGGTGG + Intergenic
1153802942 18:8687075-8687097 GCAGAGTAAGTCTGGGCAAGTGG - Intergenic
1154946554 18:21167411-21167433 CCACAGAGACTATGGGGAAGAGG - Intergenic
1155608745 18:27638193-27638215 CCATAGTAATTATGGGAAAGGGG + Intergenic
1156992835 18:43430529-43430551 CCACAGGAGGTATGGTCAGTGGG + Intergenic
1158116907 18:54005716-54005738 CCTGAGGAAGTAGGGGCCAGAGG + Intergenic
1159187990 18:65003329-65003351 CAACAGGAATTATGGGGAATAGG + Intergenic
1160899206 19:1418717-1418739 CCGAAGGAAGGATGGGTAAGGGG + Exonic
1161615683 19:5268940-5268962 GCCCAGGAAGGATGGACAAGAGG - Intronic
1164484349 19:28641994-28642016 TAACAGTCAGTATGGGCAAGGGG - Intergenic
1164484364 19:28642065-28642087 CAACAGTCAGTATGGGCAAGGGG - Intergenic
1166177235 19:41082877-41082899 CCACAGGAAGAATGGGAGATGGG - Intergenic
1166326856 19:42056393-42056415 GCACAGGAAGCAGGGGGAAGAGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1166468989 19:43061082-43061104 TCACAGGAAGTAATGGCCAGTGG - Intronic
1168582938 19:57570391-57570413 CACCAGGCAGTATGTGCAAGAGG + Intergenic
928258083 2:29742291-29742313 CCACAGTAGGTATGGGCGAATGG + Intronic
928977688 2:37105789-37105811 ACCCAGGAAGTCTGGACAAGGGG - Exonic
938313143 2:130307812-130307834 GCACAGGAAGTATCAGCAAAGGG - Intergenic
938955341 2:136292563-136292585 ACACAGGAAGTCTTGGCACGTGG - Intergenic
940396871 2:153199567-153199589 CCACAGTAAGGACAGGCAAGAGG - Intergenic
942597677 2:177607843-177607865 CCACATATAGCATGGGCAAGTGG + Intergenic
945011384 2:205467709-205467731 CCACTGGAAGTATGTTGAAGGGG - Intronic
945137593 2:206644855-206644877 TCACAGGAAGTATGAGGATGAGG - Intergenic
946952770 2:224895260-224895282 CCACAGGAAATATAGCAAAGTGG + Intronic
947907499 2:233775944-233775966 CAAGAGGAAGTATGAGCAAGAGG - Intronic
948545575 2:238726260-238726282 TGACAGGAAGTGTGGGCAAGAGG + Intergenic
1170898630 20:20438588-20438610 CCACAGGCAGCATGGGCCCGGGG + Intronic
1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG + Intergenic
1173435133 20:43025569-43025591 GCACAGGATGCATTGGCAAGAGG - Intronic
1174035085 20:47663883-47663905 ACACAGGAAGGAGGGGAAAGGGG - Intronic
1175298397 20:57925417-57925439 CCACAAGAAAGATGGGCAAAAGG - Intergenic
1176274229 20:64254811-64254833 CCACGCGAAGTTTGGGCAATGGG + Intergenic
1179056908 21:37944732-37944754 CTACAGGGAGTCTGGGCAGGGGG + Intergenic
1180211103 21:46295865-46295887 CCGCAGGAGCAATGGGCAAGGGG - Intronic
1181437719 22:22920191-22920213 ACACAGCACGTATGGGAAAGGGG - Intergenic
1182010881 22:26999734-26999756 GCACAGGAAGCAAGGGGAAGTGG - Intergenic
1183874783 22:40770675-40770697 GCACAGGGAGTATGGCCAACTGG - Exonic
1185205511 22:49535781-49535803 CCCCCGGGAGGATGGGCAAGGGG + Intronic
951156953 3:19367062-19367084 CCACAAGAAGGAGGAGCAAGTGG - Intronic
951170805 3:19539696-19539718 CCAGAGGAACTGTGGGTAAGAGG - Intergenic
951844797 3:27073636-27073658 CCACAGGAAGAACTTGCAAGAGG + Intergenic
952252414 3:31667205-31667227 TCAGAGGCAGTGTGGGCAAGGGG + Intronic
953627893 3:44585735-44585757 CCACAGAAAGTCTGCACAAGGGG - Intronic
954683746 3:52359549-52359571 CCACAGGAAGGACGGGCCTGAGG + Intronic
958730940 3:97959427-97959449 ACACAGGAAGCTAGGGCAAGAGG - Intronic
959101696 3:102017491-102017513 CCTCAGGAAGTATGAAGAAGTGG - Intergenic
962424699 3:135259447-135259469 CCACAGGAAGAAAGGGAAGGAGG + Exonic
962556683 3:136559694-136559716 CCACAGGAACTATTAGCATGAGG + Intronic
962578929 3:136780195-136780217 CCACAGGAAGAATGGTCCACAGG + Intergenic
963762874 3:149302088-149302110 CCAAAGCAAAAATGGGCAAGTGG - Intergenic
965854453 3:173071436-173071458 CCAAAGGAAAAATGGGCAAATGG + Intronic
967733444 3:192927657-192927679 CCCCAGGAAGTATTTACAAGAGG + Intergenic
968544546 4:1192041-1192063 CCACAGCAAGGAGGGGCCAGAGG + Intronic
969141419 4:5077543-5077565 CCACAGGAAGGCTGTGCAATGGG - Intronic
969886812 4:10222279-10222301 CCACTGGGAGTTTTGGCAAGTGG + Intergenic
970546313 4:17133855-17133877 AGGCAGGAAGTATGGGCAATAGG - Intergenic
971074217 4:23129332-23129354 CCAAAGGCAGTTTGGGGAAGGGG + Intergenic
971169633 4:24219817-24219839 CAACAGGACGGATGGGCAGGTGG - Intergenic
971226854 4:24762183-24762205 TCCCAGGAAGTCTGGGAAAGTGG + Intergenic
971454893 4:26834974-26834996 CCACAGGGAGTAAGGGCTAAGGG - Intergenic
972344189 4:38179015-38179037 CCACAGGAAATCAGGGCAAAGGG - Intergenic
972480441 4:39491396-39491418 CTACAGGAGGTATGGGATAGGGG - Intergenic
973216617 4:47676310-47676332 CCACAGGAATTTTGGTCAAGCGG + Intronic
973539785 4:51924471-51924493 CCCCTGGAAATATGGGGAAGAGG - Intergenic
973975892 4:56261961-56261983 CCACAGGGATTATGGGGAAATGG + Intronic
974335320 4:60536321-60536343 CCACAGGTAGTGTAGGCAAAGGG - Intergenic
976498512 4:85758544-85758566 CCTAAGGAAATTTGGGCAAGAGG + Intronic
977534321 4:98239298-98239320 ACACAGGAAATATTGGCAAAGGG + Intergenic
978724512 4:111954712-111954734 CTACAGGAGGTTTGGGGAAGAGG + Intergenic
981173000 4:141646448-141646470 CCAAAGCAGGTATGGGGAAGGGG - Intronic
981915114 4:150024820-150024842 CCAAATAAAGCATGGGCAAGTGG + Intergenic
984256217 4:177392933-177392955 CCACAGGCAGAATGGGAGAGTGG - Intergenic
984597692 4:181689447-181689469 GCACAGGAAGTAAAGGAAAGGGG + Intergenic
986386902 5:7243614-7243636 CCACAGGGAGTAAGGGAAGGTGG + Intergenic
986699843 5:10395689-10395711 CCAGAGGAAGAATGGGCTTGAGG + Intronic
986877141 5:12125831-12125853 ACCCAGGAAGTAAGTGCAAGAGG + Intergenic
987640528 5:20606267-20606289 CAACAGGAAGTTTGAGCAGGAGG - Intergenic
989130849 5:38105361-38105383 CCACTGGAGGTTTGGGCCAGAGG - Intergenic
990138022 5:52670661-52670683 CCAGAGGAAGTATGGGCATGAGG + Intergenic
990138101 5:52671312-52671334 GCACAGGAAGGATGGGGAATTGG - Intergenic
998920097 5:147058672-147058694 CCACATGCAGAATGGGCAAGAGG + Intronic
999041903 5:148423232-148423254 CTACAGGAACTATGAGCAAGTGG - Intronic
999082781 5:148859919-148859941 TCAAAGGAAGTATGGTCAATGGG - Intergenic
999212238 5:149899930-149899952 ACATAGGAAGTCAGGGCAAGAGG - Intronic
1001330108 5:170755843-170755865 ACACAGGAAGTTTGGCCAATTGG + Intergenic
1004179967 6:13372568-13372590 CCCCTGGGAGTCTGGGCAAGGGG + Intronic
1007253347 6:40511455-40511477 CCACGGGAAGTAGGGGCAGTGGG + Intronic
1007253480 6:40512271-40512293 CCACAGGAAGCGGGGGCAATGGG - Intronic
1008102039 6:47402010-47402032 CCCCAAGAAGGATGTGCAAGAGG + Intergenic
1008176749 6:48277552-48277574 CAACAGGAAGCATGTGGAAGTGG + Intergenic
1010775972 6:79886216-79886238 CCAAAGCAAATATGGGCAAATGG + Intergenic
1011263338 6:85490728-85490750 CCACAGGAATTTTGGTGAAGGGG - Intronic
1011927544 6:92666197-92666219 CCACAGGTACTATGGGAGAGAGG - Intergenic
1015005831 6:128280526-128280548 ACACAGAAAGTATGGCCAATGGG - Intronic
1021108839 7:16671189-16671211 GGACAGGAAGTATGGGGATGGGG - Intronic
1021678003 7:23100268-23100290 CTACTGGAAGTATGTACAAGGGG - Intergenic
1021746342 7:23745109-23745131 CCACAGGTAGCATGTGCAAGTGG + Intronic
1022415735 7:30175500-30175522 CCCTAGGATGTATGGGCATGAGG + Intergenic
1023039357 7:36158920-36158942 CCACAGGGAAAATGAGCAAGTGG - Intronic
1023887962 7:44374503-44374525 CCACAGGAAGTTTAGGGAGGGGG - Intergenic
1029058854 7:97776377-97776399 CAACAGGAAGAATTGGCAGGAGG + Intergenic
1029276614 7:99408816-99408838 CCACCGGAAGTGAGGGCAAATGG + Exonic
1030514992 7:110528032-110528054 CCAAAGGACTTATGGGCCAGTGG - Intergenic
1032069162 7:128793001-128793023 TCACAGGAAGTACTGGCAAATGG - Intronic
1032808382 7:135382023-135382045 CCTTAGGAAGTGTGGTCAAGAGG + Intronic
1041019991 8:53629076-53629098 CCAAAGGAAAGATGGGCAAAAGG - Intergenic
1041197383 8:55413783-55413805 CTACAGGAAGGAGGGGAAAGCGG - Intronic
1041462239 8:58123833-58123855 CCAAAGGAAGTATGCGCAGCGGG - Intronic
1044809224 8:96040346-96040368 CCACAAGATGGATGGACAAGAGG - Intergenic
1046686728 8:117236048-117236070 CCACAGGTATTTTTGGCAAGTGG + Intergenic
1050462460 9:5888076-5888098 CCTCAGGTATTATGGGAAAGGGG + Intronic
1057498700 9:95580060-95580082 AGACAGGATGTATTGGCAAGAGG - Intergenic
1057514302 9:95708399-95708421 CCTCAGCAAGAATGGTCAAGTGG - Intergenic
1057859920 9:98632943-98632965 CCTCAGGAAGTACAGGCTAGTGG + Intronic
1058831098 9:108817237-108817259 CCACAGAAGGAATGGTCAAGGGG + Intergenic
1059655683 9:116355252-116355274 TCACAGGAATTAAGGGCAGGAGG + Intronic
1061733292 9:132633926-132633948 TTACAGGAAGTATGGGAAAGAGG + Intronic
1185765566 X:2723342-2723364 CCACAGGAAAGAAGGGGAAGAGG + Exonic
1187719845 X:22138992-22139014 CAACAGGAAGTATGGTATAGAGG + Intronic
1188981982 X:36734781-36734803 CCAAAGGAGGTATTGGCAAGGGG - Intergenic
1189025962 X:37394706-37394728 TCACAGGAAGCCTGGGAAAGAGG + Intronic
1191836913 X:65473362-65473384 CCAAAGAAATTTTGGGCAAGAGG - Intronic
1192052248 X:67735338-67735360 CCACTTGAAGTTTGGGGAAGAGG - Intergenic
1196035065 X:111135061-111135083 CCACAGGAGGAATCGGGAAGAGG + Intronic
1197535271 X:127679730-127679752 CCAAATAAAGCATGGGCAAGTGG - Intergenic
1197853942 X:130894781-130894803 CCACTGAAAGCATGGGAAAGGGG - Intronic
1199678623 X:150208421-150208443 CCACAGGCAGTGAGGCCAAGTGG - Intergenic