ID: 1170944570

View in Genome Browser
Species Human (GRCh38)
Location 20:20879636-20879658
Sequence GCAGACTGTCATTCTTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170944570_1170944576 8 Left 1170944570 20:20879636-20879658 CCTGACAAAGAATGACAGTCTGC No data
Right 1170944576 20:20879667-20879689 AACGTCTGGGAGCCTCTGAAGGG No data
1170944570_1170944572 -6 Left 1170944570 20:20879636-20879658 CCTGACAAAGAATGACAGTCTGC No data
Right 1170944572 20:20879653-20879675 GTCTGCCATGGAACAACGTCTGG No data
1170944570_1170944573 -5 Left 1170944570 20:20879636-20879658 CCTGACAAAGAATGACAGTCTGC No data
Right 1170944573 20:20879654-20879676 TCTGCCATGGAACAACGTCTGGG No data
1170944570_1170944575 7 Left 1170944570 20:20879636-20879658 CCTGACAAAGAATGACAGTCTGC No data
Right 1170944575 20:20879666-20879688 CAACGTCTGGGAGCCTCTGAAGG No data
1170944570_1170944577 19 Left 1170944570 20:20879636-20879658 CCTGACAAAGAATGACAGTCTGC No data
Right 1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170944570 Original CRISPR GCAGACTGTCATTCTTTGTC AGG (reversed) Intergenic
No off target data available for this crispr