ID: 1170944574

View in Genome Browser
Species Human (GRCh38)
Location 20:20879658-20879680
Sequence GGCTCCCAGACGTTGTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170944574_1170944577 -3 Left 1170944574 20:20879658-20879680 CCATGGAACAACGTCTGGGAGCC No data
Right 1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170944574 Original CRISPR GGCTCCCAGACGTTGTTCCA TGG (reversed) Intergenic
No off target data available for this crispr