ID: 1170944577

View in Genome Browser
Species Human (GRCh38)
Location 20:20879678-20879700
Sequence GCCTCTGAAGGGTTTTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170944574_1170944577 -3 Left 1170944574 20:20879658-20879680 CCATGGAACAACGTCTGGGAGCC No data
Right 1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG No data
1170944570_1170944577 19 Left 1170944570 20:20879636-20879658 CCTGACAAAGAATGACAGTCTGC No data
Right 1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170944577 Original CRISPR GCCTCTGAAGGGTTTTGAGT AGG Intergenic
No off target data available for this crispr