ID: 1170946123

View in Genome Browser
Species Human (GRCh38)
Location 20:20892377-20892399
Sequence AGAGTCGGTCTCAGCTCCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170946123_1170946126 -4 Left 1170946123 20:20892377-20892399 CCGTAGGAGCTGAGACCGACTCT No data
Right 1170946126 20:20892396-20892418 CTCTTGGCCTACAGTCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170946123 Original CRISPR AGAGTCGGTCTCAGCTCCTA CGG (reversed) Intergenic