ID: 1170947481

View in Genome Browser
Species Human (GRCh38)
Location 20:20904302-20904324
Sequence CTGGACAAACTCCCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170947481_1170947486 -10 Left 1170947481 20:20904302-20904324 CCTTCCTCAGGGAGTTTGTCCAG No data
Right 1170947486 20:20904315-20904337 GTTTGTCCAGAGGGAATAATGGG No data
1170947481_1170947493 19 Left 1170947481 20:20904302-20904324 CCTTCCTCAGGGAGTTTGTCCAG No data
Right 1170947493 20:20904344-20904366 CTGGAGCTGGAGGTGCCTCCAGG No data
1170947481_1170947494 20 Left 1170947481 20:20904302-20904324 CCTTCCTCAGGGAGTTTGTCCAG No data
Right 1170947494 20:20904345-20904367 TGGAGCTGGAGGTGCCTCCAGGG No data
1170947481_1170947490 9 Left 1170947481 20:20904302-20904324 CCTTCCTCAGGGAGTTTGTCCAG No data
Right 1170947490 20:20904334-20904356 TGGGCCCATGCTGGAGCTGGAGG No data
1170947481_1170947488 0 Left 1170947481 20:20904302-20904324 CCTTCCTCAGGGAGTTTGTCCAG No data
Right 1170947488 20:20904325-20904347 AGGGAATAATGGGCCCATGCTGG No data
1170947481_1170947489 6 Left 1170947481 20:20904302-20904324 CCTTCCTCAGGGAGTTTGTCCAG No data
Right 1170947489 20:20904331-20904353 TAATGGGCCCATGCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170947481 Original CRISPR CTGGACAAACTCCCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr