ID: 1170950037

View in Genome Browser
Species Human (GRCh38)
Location 20:20928113-20928135
Sequence TAGGTCCCCCAAAATGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170950036_1170950037 -5 Left 1170950036 20:20928095-20928117 CCAGCATTGCAAATTAATTAGGT No data
Right 1170950037 20:20928113-20928135 TAGGTCCCCCAAAATGCTTGTGG No data
1170950034_1170950037 0 Left 1170950034 20:20928090-20928112 CCGCACCAGCATTGCAAATTAAT No data
Right 1170950037 20:20928113-20928135 TAGGTCCCCCAAAATGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170950037 Original CRISPR TAGGTCCCCCAAAATGCTTG TGG Intergenic
No off target data available for this crispr