ID: 1170954254

View in Genome Browser
Species Human (GRCh38)
Location 20:20964006-20964028
Sequence AAGTGAAGGTAGAAGAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170954243_1170954254 15 Left 1170954243 20:20963968-20963990 CCATCATGATGACAAACTGCCCC No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954249_1170954254 -7 Left 1170954249 20:20963990-20964012 CCATGGCAAGCAATGGAAGTGAA No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954240_1170954254 30 Left 1170954240 20:20963953-20963975 CCCCACTCAGCTGCACCATCATG No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954246_1170954254 -4 Left 1170954246 20:20963987-20964009 CCCCCATGGCAAGCAATGGAAGT No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954241_1170954254 29 Left 1170954241 20:20963954-20963976 CCCACTCAGCTGCACCATCATGA No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954242_1170954254 28 Left 1170954242 20:20963955-20963977 CCACTCAGCTGCACCATCATGAT No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954247_1170954254 -5 Left 1170954247 20:20963988-20964010 CCCCATGGCAAGCAATGGAAGTG No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data
1170954248_1170954254 -6 Left 1170954248 20:20963989-20964011 CCCATGGCAAGCAATGGAAGTGA No data
Right 1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170954254 Original CRISPR AAGTGAAGGTAGAAGAATGG GGG Intergenic
No off target data available for this crispr