ID: 1170956281

View in Genome Browser
Species Human (GRCh38)
Location 20:20982814-20982836
Sequence TTATTTGGAATGTCCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170956281_1170956283 -7 Left 1170956281 20:20982814-20982836 CCTTGCAGGGACATTCCAAATAA No data
Right 1170956283 20:20982830-20982852 CAAATAAACAGATACAGTAAAGG No data
1170956281_1170956284 -6 Left 1170956281 20:20982814-20982836 CCTTGCAGGGACATTCCAAATAA No data
Right 1170956284 20:20982831-20982853 AAATAAACAGATACAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170956281 Original CRISPR TTATTTGGAATGTCCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr