ID: 1170956283

View in Genome Browser
Species Human (GRCh38)
Location 20:20982830-20982852
Sequence CAAATAAACAGATACAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170956280_1170956283 -3 Left 1170956280 20:20982810-20982832 CCTACCTTGCAGGGACATTCCAA No data
Right 1170956283 20:20982830-20982852 CAAATAAACAGATACAGTAAAGG No data
1170956281_1170956283 -7 Left 1170956281 20:20982814-20982836 CCTTGCAGGGACATTCCAAATAA No data
Right 1170956283 20:20982830-20982852 CAAATAAACAGATACAGTAAAGG No data
1170956277_1170956283 20 Left 1170956277 20:20982787-20982809 CCTGAAAAGTGGGACTGCTAAAG No data
Right 1170956283 20:20982830-20982852 CAAATAAACAGATACAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170956283 Original CRISPR CAAATAAACAGATACAGTAA AGG Intergenic
No off target data available for this crispr