ID: 1170956284

View in Genome Browser
Species Human (GRCh38)
Location 20:20982831-20982853
Sequence AAATAAACAGATACAGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170956277_1170956284 21 Left 1170956277 20:20982787-20982809 CCTGAAAAGTGGGACTGCTAAAG No data
Right 1170956284 20:20982831-20982853 AAATAAACAGATACAGTAAAGGG No data
1170956280_1170956284 -2 Left 1170956280 20:20982810-20982832 CCTACCTTGCAGGGACATTCCAA No data
Right 1170956284 20:20982831-20982853 AAATAAACAGATACAGTAAAGGG No data
1170956281_1170956284 -6 Left 1170956281 20:20982814-20982836 CCTTGCAGGGACATTCCAAATAA No data
Right 1170956284 20:20982831-20982853 AAATAAACAGATACAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170956284 Original CRISPR AAATAAACAGATACAGTAAA GGG Intergenic
No off target data available for this crispr