ID: 1170959211

View in Genome Browser
Species Human (GRCh38)
Location 20:21010194-21010216
Sequence GGAACTGAGCTCTTCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170959211_1170959221 28 Left 1170959211 20:21010194-21010216 CCCACAGTGAAGAGCTCAGTTCC No data
Right 1170959221 20:21010245-21010267 ACTCCAAGTAATTGATACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170959211 Original CRISPR GGAACTGAGCTCTTCACTGT GGG (reversed) Intergenic