ID: 1170961252

View in Genome Browser
Species Human (GRCh38)
Location 20:21027803-21027825
Sequence CAGTTGGGTGGAGCAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170961252_1170961260 -1 Left 1170961252 20:21027803-21027825 CCTGGGGTTGCTCCACCCAACTG No data
Right 1170961260 20:21027825-21027847 GGCCCAGGAGAAAAGGGCTCAGG No data
1170961252_1170961264 24 Left 1170961252 20:21027803-21027825 CCTGGGGTTGCTCCACCCAACTG No data
Right 1170961264 20:21027850-21027872 GAAACCATTTTGAAAGAGTTGGG No data
1170961252_1170961259 -7 Left 1170961252 20:21027803-21027825 CCTGGGGTTGCTCCACCCAACTG No data
Right 1170961259 20:21027819-21027841 CCAACTGGCCCAGGAGAAAAGGG No data
1170961252_1170961257 -8 Left 1170961252 20:21027803-21027825 CCTGGGGTTGCTCCACCCAACTG No data
Right 1170961257 20:21027818-21027840 CCCAACTGGCCCAGGAGAAAAGG No data
1170961252_1170961263 23 Left 1170961252 20:21027803-21027825 CCTGGGGTTGCTCCACCCAACTG No data
Right 1170961263 20:21027849-21027871 AGAAACCATTTTGAAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170961252 Original CRISPR CAGTTGGGTGGAGCAACCCC AGG (reversed) Intergenic
No off target data available for this crispr