ID: 1170962241

View in Genome Browser
Species Human (GRCh38)
Location 20:21035768-21035790
Sequence ATTGAGGAGCAAAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170962235_1170962241 22 Left 1170962235 20:21035723-21035745 CCTCTGTTTCTCCAAAGGCTTTG No data
Right 1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG No data
1170962234_1170962241 26 Left 1170962234 20:21035719-21035741 CCAACCTCTGTTTCTCCAAAGGC No data
Right 1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG No data
1170962238_1170962241 11 Left 1170962238 20:21035734-21035756 CCAAAGGCTTTGGGCTTAAACAC No data
Right 1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170962241 Original CRISPR ATTGAGGAGCAAAAAGAGGA AGG Intergenic
No off target data available for this crispr