ID: 1170962692

View in Genome Browser
Species Human (GRCh38)
Location 20:21039443-21039465
Sequence GTGGAGCATCAGCAAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170962692_1170962697 13 Left 1170962692 20:21039443-21039465 CCAGCCACTTGCTGATGCTCCAC No data
Right 1170962697 20:21039479-21039501 AGTTTCAACCTGAGCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170962692 Original CRISPR GTGGAGCATCAGCAAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr