ID: 1170964841

View in Genome Browser
Species Human (GRCh38)
Location 20:21058593-21058615
Sequence CTGGAGAATTCCTCTTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170964836_1170964841 2 Left 1170964836 20:21058568-21058590 CCTGGGATCCTTGTTCTCCATCC No data
Right 1170964841 20:21058593-21058615 CTGGAGAATTCCTCTTATGATGG No data
1170964835_1170964841 3 Left 1170964835 20:21058567-21058589 CCCTGGGATCCTTGTTCTCCATC No data
Right 1170964841 20:21058593-21058615 CTGGAGAATTCCTCTTATGATGG No data
1170964838_1170964841 -6 Left 1170964838 20:21058576-21058598 CCTTGTTCTCCATCCTTCTGGAG No data
Right 1170964841 20:21058593-21058615 CTGGAGAATTCCTCTTATGATGG No data
1170964834_1170964841 9 Left 1170964834 20:21058561-21058583 CCATCACCCTGGGATCCTTGTTC No data
Right 1170964841 20:21058593-21058615 CTGGAGAATTCCTCTTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170964841 Original CRISPR CTGGAGAATTCCTCTTATGA TGG Intergenic
No off target data available for this crispr