ID: 1170969683

View in Genome Browser
Species Human (GRCh38)
Location 20:21105254-21105276
Sequence GGGGTTGTTCAGACCCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170969683_1170969706 27 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969706 20:21105304-21105326 GTTGTTTCCTAGGGTCTTCTGGG No data
1170969683_1170969702 18 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969683_1170969700 17 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969700 20:21105294-21105316 ACCCCAAGGTGTTGTTTCCTAGG No data
1170969683_1170969705 26 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969705 20:21105303-21105325 TGTTGTTTCCTAGGGTCTTCTGG No data
1170969683_1170969690 3 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969690 20:21105280-21105302 GTCCCCCGCCCCCCACCCCAAGG No data
1170969683_1170969707 28 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170969683 Original CRISPR GGGGTTGTTCAGACCCAGAG CGG (reversed) Intergenic