ID: 1170969690

View in Genome Browser
Species Human (GRCh38)
Location 20:21105280-21105302
Sequence GTCCCCCGCCCCCCACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170969680_1170969690 8 Left 1170969680 20:21105249-21105271 CCCTCCCGCTCTGGGTCTGAACA No data
Right 1170969690 20:21105280-21105302 GTCCCCCGCCCCCCACCCCAAGG No data
1170969683_1170969690 3 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969690 20:21105280-21105302 GTCCCCCGCCCCCCACCCCAAGG No data
1170969682_1170969690 4 Left 1170969682 20:21105253-21105275 CCCGCTCTGGGTCTGAACAACCC No data
Right 1170969690 20:21105280-21105302 GTCCCCCGCCCCCCACCCCAAGG No data
1170969681_1170969690 7 Left 1170969681 20:21105250-21105272 CCTCCCGCTCTGGGTCTGAACAA No data
Right 1170969690 20:21105280-21105302 GTCCCCCGCCCCCCACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170969690 Original CRISPR GTCCCCCGCCCCCCACCCCA AGG Intergenic