ID: 1170969690 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:21105280-21105302 |
| Sequence | GTCCCCCGCCCCCCACCCCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170969680_1170969690 | 8 | Left | 1170969680 | 20:21105249-21105271 | CCCTCCCGCTCTGGGTCTGAACA | No data | ||
| Right | 1170969690 | 20:21105280-21105302 | GTCCCCCGCCCCCCACCCCAAGG | No data | ||||
| 1170969683_1170969690 | 3 | Left | 1170969683 | 20:21105254-21105276 | CCGCTCTGGGTCTGAACAACCCC | No data | ||
| Right | 1170969690 | 20:21105280-21105302 | GTCCCCCGCCCCCCACCCCAAGG | No data | ||||
| 1170969682_1170969690 | 4 | Left | 1170969682 | 20:21105253-21105275 | CCCGCTCTGGGTCTGAACAACCC | No data | ||
| Right | 1170969690 | 20:21105280-21105302 | GTCCCCCGCCCCCCACCCCAAGG | No data | ||||
| 1170969681_1170969690 | 7 | Left | 1170969681 | 20:21105250-21105272 | CCTCCCGCTCTGGGTCTGAACAA | No data | ||
| Right | 1170969690 | 20:21105280-21105302 | GTCCCCCGCCCCCCACCCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170969690 | Original CRISPR | GTCCCCCGCCCCCCACCCCA AGG | Intergenic | ||