ID: 1170969702

View in Genome Browser
Species Human (GRCh38)
Location 20:21105295-21105317
Sequence CCCCAAGGTGTTGTTTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170969691_1170969702 -10 Left 1170969691 20:21105282-21105304 CCCCCGCCCCCCACCCCAAGGTG No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969689_1170969702 -6 Left 1170969689 20:21105278-21105300 CCGTCCCCCGCCCCCCACCCCAA No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969687_1170969702 -4 Left 1170969687 20:21105276-21105298 CCCCGTCCCCCGCCCCCCACCCC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969683_1170969702 18 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969680_1170969702 23 Left 1170969680 20:21105249-21105271 CCCTCCCGCTCTGGGTCTGAACA No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969688_1170969702 -5 Left 1170969688 20:21105277-21105299 CCCGTCCCCCGCCCCCCACCCCA No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969686_1170969702 -3 Left 1170969686 20:21105275-21105297 CCCCCGTCCCCCGCCCCCCACCC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969681_1170969702 22 Left 1170969681 20:21105250-21105272 CCTCCCGCTCTGGGTCTGAACAA No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969685_1170969702 -2 Left 1170969685 20:21105274-21105296 CCCCCCGTCCCCCGCCCCCCACC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969682_1170969702 19 Left 1170969682 20:21105253-21105275 CCCGCTCTGGGTCTGAACAACCC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data
1170969684_1170969702 -1 Left 1170969684 20:21105273-21105295 CCCCCCCGTCCCCCGCCCCCCAC No data
Right 1170969702 20:21105295-21105317 CCCCAAGGTGTTGTTTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170969702 Original CRISPR CCCCAAGGTGTTGTTTCCTA GGG Intergenic