ID: 1170969707

View in Genome Browser
Species Human (GRCh38)
Location 20:21105305-21105327
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170969694_1170969707 -3 Left 1170969694 20:21105285-21105307 CCGCCCCCCACCCCAAGGTGTTG No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969692_1170969707 -1 Left 1170969692 20:21105283-21105305 CCCCGCCCCCCACCCCAAGGTGT No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969697_1170969707 -8 Left 1170969697 20:21105290-21105312 CCCCACCCCAAGGTGTTGTTTCC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969696_1170969707 -7 Left 1170969696 20:21105289-21105311 CCCCCACCCCAAGGTGTTGTTTC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969689_1170969707 4 Left 1170969689 20:21105278-21105300 CCGTCCCCCGCCCCCCACCCCAA No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969691_1170969707 0 Left 1170969691 20:21105282-21105304 CCCCCGCCCCCCACCCCAAGGTG No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969695_1170969707 -6 Left 1170969695 20:21105288-21105310 CCCCCCACCCCAAGGTGTTGTTT No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969684_1170969707 9 Left 1170969684 20:21105273-21105295 CCCCCCCGTCCCCCGCCCCCCAC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969687_1170969707 6 Left 1170969687 20:21105276-21105298 CCCCGTCCCCCGCCCCCCACCCC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969698_1170969707 -9 Left 1170969698 20:21105291-21105313 CCCACCCCAAGGTGTTGTTTCCT No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969686_1170969707 7 Left 1170969686 20:21105275-21105297 CCCCCGTCCCCCGCCCCCCACCC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969699_1170969707 -10 Left 1170969699 20:21105292-21105314 CCACCCCAAGGTGTTGTTTCCTA No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969693_1170969707 -2 Left 1170969693 20:21105284-21105306 CCCGCCCCCCACCCCAAGGTGTT No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969685_1170969707 8 Left 1170969685 20:21105274-21105296 CCCCCCGTCCCCCGCCCCCCACC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969682_1170969707 29 Left 1170969682 20:21105253-21105275 CCCGCTCTGGGTCTGAACAACCC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969683_1170969707 28 Left 1170969683 20:21105254-21105276 CCGCTCTGGGTCTGAACAACCCC No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data
1170969688_1170969707 5 Left 1170969688 20:21105277-21105299 CCCGTCCCCCGCCCCCCACCCCA No data
Right 1170969707 20:21105305-21105327 TTGTTTCCTAGGGTCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170969707 Original CRISPR TTGTTTCCTAGGGTCTTCTG GGG Intergenic