ID: 1170971342

View in Genome Browser
Species Human (GRCh38)
Location 20:21119452-21119474
Sequence AGTAGTGAGTCTCTAGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170971340_1170971342 -10 Left 1170971340 20:21119439-21119461 CCCATCTCGTTTAAGTAGTGAGT No data
Right 1170971342 20:21119452-21119474 AGTAGTGAGTCTCTAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170971342 Original CRISPR AGTAGTGAGTCTCTAGCTAG AGG Intergenic
No off target data available for this crispr