ID: 1170973321

View in Genome Browser
Species Human (GRCh38)
Location 20:21137320-21137342
Sequence CAAATTATGCCAAGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170973316_1170973321 7 Left 1170973316 20:21137290-21137312 CCTGCTGCTGCTTGGCTTCCTGC 0: 1
1: 1
2: 8
3: 82
4: 688
Right 1170973321 20:21137320-21137342 CAAATTATGCCAAGTGTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170973321 Original CRISPR CAAATTATGCCAAGTGTGGA GGG Intronic
900511466 1:3062968-3062990 CAAATCCTGCAGAGTGTGGAGGG - Intergenic
903972684 1:27129338-27129360 CAAACTATCCCCAGTGTGGTGGG - Intronic
904329435 1:29748385-29748407 CAAATTATCCCTGGAGTGGATGG + Intergenic
904383092 1:30124619-30124641 CCAATTATCCTAAGGGTGGAGGG + Intergenic
908575759 1:65458162-65458184 CAAATTATGGTAATAGTGGAGGG + Intronic
909814807 1:79978285-79978307 CAAATTATGACAATTGTGCTTGG + Intergenic
910671114 1:89773812-89773834 CAAATCATGCCAGTTGGGGAGGG + Intronic
916090406 1:161304645-161304667 CAACTGAAGCCAAGTATGGAAGG + Intergenic
916482242 1:165224999-165225021 CAAATTATGCTAATTAGGGATGG + Intronic
917466214 1:175278739-175278761 TCAATTATGCCCACTGTGGAAGG + Intergenic
917576415 1:176325823-176325845 GAAAATAGGCCAAGTGTGAAGGG + Intergenic
918871917 1:189985429-189985451 CAAATGATACCAAGCTTGGAAGG + Intergenic
919503123 1:198363228-198363250 CATATTGTGCCAAGTTTTGAAGG - Intergenic
921636947 1:217506689-217506711 CACATGATGCCAAGTCTGGTAGG - Intronic
922050218 1:221982043-221982065 CAAACAATGGCAAGTGTAGAAGG - Intergenic
922575096 1:226655904-226655926 CAGATGGTGCCATGTGTGGATGG - Intronic
922948127 1:229534579-229534601 AAAATTAGGCCAGGCGTGGATGG + Intronic
1062828996 10:593059-593081 CAAATTATGCCAGTAGTGGCCGG + Intronic
1067016843 10:42763418-42763440 GAATTTATGCCAAGAATGGAAGG + Intergenic
1067939469 10:50641844-50641866 GGAATTATGCCAAGAGTAGATGG - Intergenic
1069705159 10:70454714-70454736 AAAAATTAGCCAAGTGTGGAGGG + Intergenic
1072299726 10:94047583-94047605 CAATTTCTGCAAAGTGTAGAAGG - Intronic
1074958651 10:118418597-118418619 CAAATAATGCCAACTATGGAGGG - Intergenic
1075350282 10:121718253-121718275 TAAATTATCTCAAGTGTGGATGG + Intergenic
1075463389 10:122633266-122633288 CAAACAATGCCAAGTGTGTGTGG + Exonic
1077393389 11:2309922-2309944 CAAATGATGCCAGGGGTGGGTGG - Intronic
1078205875 11:9228949-9228971 CAAATTATGCAAACTTAGGAAGG + Intronic
1079095928 11:17510055-17510077 CAAGTTATGCCATCTGTGGGTGG + Intronic
1079315922 11:19407752-19407774 CACAAAATGCCGAGTGTGGAAGG - Intronic
1082894852 11:58179317-58179339 CAAAATATGCCAGGTGTGCCAGG - Intronic
1083421113 11:62553791-62553813 CACAGCATACCAAGTGTGGAGGG - Intronic
1083635499 11:64118533-64118555 CAAGTTATGCCAGTTGGGGAGGG + Exonic
1083645466 11:64169986-64170008 AAAATTTTGCCAGGTATGGAAGG + Intergenic
1087417880 11:97881707-97881729 CAAATTATGCAAAAAGTTGATGG + Intergenic
1087586999 11:100134415-100134437 CAAATTATGACACGGGTGGTAGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089770822 11:120801520-120801542 AACATTATGCTAAGTGTGGCTGG - Intronic
1090168191 11:124574223-124574245 CAATTTATCCCAAGTGTGTGAGG + Intergenic
1090539514 11:127685601-127685623 GTAATTATGCAAACTGTGGATGG + Intergenic
1091425167 12:381584-381606 CAAATTATGCTAAATTTGGGTGG - Intronic
1092932118 12:13325993-13326015 AAAATTACTCCAAGTCTGGACGG - Intergenic
1095344160 12:41129726-41129748 CAAATTATGCCATGAGAGGGGGG - Intergenic
1098107202 12:67081645-67081667 CAGATTATGCAAAGCCTGGATGG + Intergenic
1098992825 12:77083948-77083970 CAAATTATGTAAAATGTAGAAGG - Intergenic
1102308917 12:111828630-111828652 AACATTATGCCAATTGTGGGTGG - Intergenic
1103829464 12:123767392-123767414 CAAATTCTGCCAAGAGACGAAGG - Intronic
1108858793 13:54828771-54828793 CAAAGTTTGCACAGTGTGGAAGG + Intergenic
1108976082 13:56444726-56444748 AAAATTGTGCCAAGTGTCCAGGG + Intergenic
1109834563 13:67840588-67840610 CACCTTATACCATGTGTGGAGGG + Intergenic
1111101151 13:83588803-83588825 CAAATTATCACAATTGAGGAAGG - Intergenic
1113152567 13:107281386-107281408 CAAATTATGCCAATTGCTAAAGG - Intronic
1113897657 13:113776169-113776191 AAAATTAACCCAAGTCTGGAGGG - Intronic
1115543129 14:34441548-34441570 CAAAATATGTTAACTGTGGAGGG - Intronic
1115753749 14:36514509-36514531 CAAACTATGCCGACTGTAGACGG + Intergenic
1116543557 14:46133620-46133642 CAAATTTTACTAAGTGGGGAAGG + Intergenic
1117107030 14:52408131-52408153 TAAATTATGTTAAGTTTGGAAGG - Intergenic
1117297704 14:54394248-54394270 CAAATTTTCCCCAGTGTGGAAGG - Intergenic
1119252866 14:73171946-73171968 CAAATTGTGACAAGTGAGAAAGG - Intronic
1125687407 15:41571662-41571684 CAAGTTTGGCCACGTGTGGATGG - Exonic
1125774842 15:42203179-42203201 AAAATTAGGCCGAGTGTGGTTGG + Intronic
1127926934 15:63555677-63555699 CAAATTCTGTGAAGTGGGGAAGG - Intronic
1129870954 15:78941031-78941053 AAAATTCTGCCAGGTGGGGATGG - Intronic
1131552367 15:93368455-93368477 CAAATAATGACAAGTATGGTTGG + Intergenic
1134124991 16:11610342-11610364 AAAATTATGCCTAGGTTGGAGGG + Intronic
1135292411 16:21251255-21251277 CAAAATAAGCCAGGTGTGGGGGG - Exonic
1135481361 16:22823129-22823151 CTAATTATGGCAAGTGTTGCCGG - Intronic
1136389649 16:29955043-29955065 CAAAATATGCAAAGTGTGGCTGG - Intronic
1140577345 16:76186633-76186655 GAGAAAATGCCAAGTGTGGATGG + Intergenic
1150783150 17:68139611-68139633 AAAATTATGCTAAGTGAGGCTGG + Intergenic
1153195381 18:2590328-2590350 CAAATGATCACAAGTTTGGATGG + Intronic
1155062286 18:22239443-22239465 CAAGTTATGTAAAGTGTGGAGGG - Intergenic
1155159419 18:23183548-23183570 CAAAGTGTGGCCAGTGTGGAAGG + Intronic
1156269881 18:35520880-35520902 CAAATTAGGCGAAGTCTTGATGG - Intergenic
1159431782 18:68362112-68362134 CAAATTCTGCCAGGTGATGAGGG + Intergenic
1163885867 19:19964277-19964299 CAATTGAGGCCAAATGTGGAGGG + Intergenic
1165274057 19:34733206-34733228 CAGATTGTGCAAAGTGAGGAAGG + Intergenic
925617550 2:5758181-5758203 CAAAATCAGCCAAGTGTGGTGGG - Intergenic
928840264 2:35597785-35597807 GAAAGTATGCCAACTGGGGAGGG - Intergenic
930255114 2:49081814-49081836 TAAATTTGGCCAAGTGTGAATGG - Intronic
933917672 2:87012704-87012726 CAAATTCAACCAACTGTGGATGG + Exonic
934005324 2:87757213-87757235 CAAATTCAACCAACTGTGGATGG - Exonic
935768283 2:106391300-106391322 CAAATTCAACCAACTGTGGATGG - Intronic
937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG + Intergenic
939567774 2:143804858-143804880 CAAACTAGGGCAAGAGTGGAGGG + Intergenic
941502558 2:166298011-166298033 CAACTTATGACAATTGTGTATGG + Intronic
942422722 2:175824563-175824585 CAAGTTATGCCAAGAGTAAATGG + Intergenic
942554384 2:177156812-177156834 CAAAATATGCCCAGAGTGGCTGG + Intergenic
942953088 2:181744110-181744132 CAAACTTTGGCAACTGTGGAAGG + Intergenic
943632857 2:190273524-190273546 CAACTTTCTCCAAGTGTGGATGG - Intronic
944174144 2:196811152-196811174 GAAATTATGCCAGGCGTAGAGGG + Intergenic
948444657 2:238022975-238022997 CAAATTATGGAAGGTGTGAAGGG + Intronic
1170107416 20:12766741-12766763 AAAATTAGGCCAAGGCTGGATGG + Intergenic
1170973321 20:21137320-21137342 CAAATTATGCCAAGTGTGGAGGG + Intronic
1171437581 20:25135216-25135238 TAAATGATGCAAAGTGTGGGAGG - Intergenic
1173218585 20:41111880-41111902 CCAATTATGACAAGTGAGAAGGG - Intronic
1174439866 20:50542075-50542097 CAAGTTATGCCAAGTGTTGATGG - Intronic
1177126936 21:17206064-17206086 CAAATTATGTCTTATGTGGATGG + Intergenic
1181923088 22:26335885-26335907 CACATTAAGCCTAGTGAGGAGGG - Intronic
1182034385 22:27186222-27186244 CAACTTACGCAAAGTGTGGCAGG + Intergenic
1182984913 22:34707190-34707212 AAAAATATGCCCAGGGTGGATGG + Intergenic
949447387 3:4149654-4149676 TTAATTGTGCCAAGTGGGGATGG - Intronic
951623059 3:24627345-24627367 CACATTATACTAAATGTGGATGG - Intergenic
954000025 3:47549194-47549216 CAAAGTATGCCAACTGTGGGTGG - Intergenic
955535422 3:59918344-59918366 TAAATTATGTCAAGTGTGGGAGG + Intronic
956601419 3:71026732-71026754 CACATTTTGCCCAGTGTGGCTGG - Intronic
961433708 3:126901732-126901754 GAAATTATGCCATGTGAGGAAGG + Intronic
962868492 3:139467681-139467703 CAGATAAGGCCAAGAGTGGACGG - Intronic
965018237 3:163189516-163189538 CAAATAATACCAAGTGTTGAGGG - Intergenic
965443908 3:168750821-168750843 CAAATTAGGTCAAGTGCTGAGGG - Intergenic
967589538 3:191257274-191257296 AAAAATATGCAAAGTGTGTAAGG - Intronic
970588985 4:17542561-17542583 CAAATTATCCCAAATTTGGCTGG + Intergenic
973992459 4:56423333-56423355 CAAATTATGCCAGGTGCAGTTGG + Intronic
976674097 4:87685404-87685426 CATATTAGGGCAAGGGTGGAAGG - Intergenic
976736144 4:88312408-88312430 CAAATCTTCCAAAGTGTGGAAGG + Intergenic
976858220 4:89629817-89629839 CAAATAATGGAAAGTGAGGAGGG + Intergenic
976867514 4:89748109-89748131 CAAATAATGCCAAGTGAAAAAGG + Intronic
978390717 4:108222561-108222583 CAAATCATGGCCAGTGTGGCAGG + Intergenic
979322273 4:119338151-119338173 CTAAATTTCCCAAGTGTGGATGG + Intergenic
980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG + Intergenic
983240251 4:165223763-165223785 CTAAATTTCCCAAGTGTGGATGG + Intronic
983533552 4:168833772-168833794 CAAAGTCTGCCAAGTCTGAAGGG - Intronic
986074314 5:4318844-4318866 CAAACAATGCCAAGTGTGACTGG - Intergenic
988131409 5:27111417-27111439 CAAATTATGCCACTTGAAGAAGG + Intronic
989754249 5:44933854-44933876 CAAAGTGTGGAAAGTGTGGAGGG - Intergenic
992090878 5:73315721-73315743 TAAATTATGCAAAATGTGGTAGG + Intergenic
996190474 5:120534643-120534665 CAACTTATGCTGAGTGTGTAAGG - Intronic
998985465 5:147751756-147751778 CCAAATGTGCCAAGTGTGGCTGG - Intronic
999903309 5:156111262-156111284 GAAATGATGCCAAGTGTGGCTGG + Intronic
1000965444 5:167650235-167650257 CAAAGTATGCTAAATGAGGAAGG - Intronic
1001193504 5:169651738-169651760 GAAATCAGGCCAAGTGCGGAGGG + Intronic
1004580505 6:16946643-16946665 CAAATCAGGCAAATTGTGGAGGG + Intergenic
1008684407 6:53908925-53908947 CAAATTTTGGCAAGGGTGGAGGG + Intronic
1009381361 6:63034672-63034694 CAGATAATGCCCTGTGTGGAGGG - Intergenic
1009569860 6:65370803-65370825 CAAATTATGCCAAATGTAGTTGG - Intronic
1010249572 6:73694039-73694061 CAAAATTAGCCAAGTGTGGATGG - Intergenic
1013382528 6:109590152-109590174 CAAATTCTGCTAAATGTTGAAGG - Intronic
1015827289 6:137328040-137328062 CAAATTGTGCCCAGTTTGGCTGG + Intergenic
1018129124 6:160711471-160711493 CAAATTCAACCAACTGTGGATGG - Intronic
1022972699 7:35532035-35532057 CAGGAAATGCCAAGTGTGGATGG + Intergenic
1023156361 7:37256473-37256495 CAGATGATGCCAAGTGTAGGAGG + Intronic
1023529623 7:41138638-41138660 CAAATTATGTCAAGTAGGGAAGG + Intergenic
1029930647 7:104366949-104366971 TTTATTTTGCCAAGTGTGGATGG + Intronic
1032027847 7:128457469-128457491 CAAAATATGGCCAGTATGGAAGG - Exonic
1032707599 7:134434637-134434659 CAGATTAGGCCACGAGTGGATGG + Intergenic
1033027577 7:137790902-137790924 AAAATTAAGCCAAGTGCTGAAGG - Intronic
1033474025 7:141673474-141673496 GAAATTATGCCAAGAGTCCAAGG - Intronic
1033723298 7:144084785-144084807 CAAAATATGCTAACGGTGGAGGG + Intergenic
1038432843 8:27513893-27513915 CAACTTTTGCCAAGTGCTGAAGG + Intronic
1038921420 8:32088970-32088992 CAAAATAGGCCATGTGTGGGAGG - Intronic
1039031367 8:33313136-33313158 CAAAGCATGCCAAGTGTTAATGG + Intergenic
1041370630 8:57156508-57156530 CACATTATCCCAAGTTTAGAAGG - Intergenic
1041607464 8:59799597-59799619 CAAAATATGCTAATGGTGGAGGG - Intergenic
1042222612 8:66488137-66488159 CAAATATTGCCAAGGGTGTAAGG + Intronic
1043596051 8:81886053-81886075 CAAATTTTCCCATTTGTGGAAGG - Intergenic
1044175914 8:89122035-89122057 AAAATTTTGCCAGGTTTGGAGGG + Intergenic
1045900381 8:107272004-107272026 CAAATGACACCAATTGTGGAAGG - Intronic
1048972161 8:139651183-139651205 CAAAATATGCCAGGTGGGGCTGG + Intronic
1049827461 8:144678760-144678782 CAAATATTGCCAAATGTGGCAGG + Intergenic
1049971435 9:825443-825465 AAAATTTTGCCAAGTGTGGTGGG + Intergenic
1050920261 9:11191780-11191802 CAAGTTATCTGAAGTGTGGAAGG - Intergenic
1053193299 9:36093054-36093076 CAGATTATGCCAAGTTAGAAGGG + Intronic
1055179047 9:73360213-73360235 GAACTTAGGCCAAGTGTCGAAGG - Intergenic
1056435585 9:86572694-86572716 CAAAATATGCCAGGTGTGGTGGG + Intergenic
1056706655 9:88957883-88957905 CACATTAGGCCAGGTGTGGTGGG + Intergenic
1058805599 9:108588211-108588233 TAATTTATGCCAAGTTTTGAAGG + Intergenic
1059347420 9:113639010-113639032 CAAATGATGCTGAGTATGGATGG - Intergenic
1185859679 X:3566071-3566093 GAAATTATATCAAGTGTAGAGGG - Intergenic
1185999310 X:4989965-4989987 CAAATCATCCCACCTGTGGAAGG - Intergenic
1186225257 X:7392232-7392254 CCCATTAAGCCAAGTGTGGTGGG + Intergenic
1187332983 X:18357359-18357381 CAATTGATGACAAGGGTGGAAGG - Intergenic
1188275704 X:28198094-28198116 GAATTTATTCTAAGTGTGGAAGG - Intergenic
1189790572 X:44600042-44600064 CAGATTTTTCCAAGTGTGGTGGG - Intergenic
1190586751 X:51952033-51952055 CAAAATATTCAAAGTGTTGAGGG + Intergenic
1191613713 X:63145400-63145422 CAGAAAATGCCAAATGTGGACGG + Intergenic
1191622583 X:63233527-63233549 CAGAAAATGCCAAATGTGGACGG - Intergenic
1196753095 X:119135194-119135216 CAGATTTTGCCAAGTGAGGAAGG - Intronic
1197424722 X:126281827-126281849 TAAATTATGTCAAATGTGGCAGG - Intergenic
1200806042 Y:7434788-7434810 GAAATTATATCAAGTGTAGAGGG + Intergenic
1201381295 Y:13382643-13382665 GAAATTATACAACGTGTGGAGGG + Intronic