ID: 1170974411

View in Genome Browser
Species Human (GRCh38)
Location 20:21149140-21149162
Sequence GTTTGAATATTGGTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170974411 Original CRISPR GTTTGAATATTGGTTCTGCC TGG (reversed) Intronic
902172698 1:14625902-14625924 GTATGAATATGGGTGCGGCCAGG - Intronic
903158593 1:21468167-21468189 GTTGGGAAACTGGTTCTGCCTGG + Intronic
905102079 1:35532718-35532740 GATTTAATATTGCTTTTGCCTGG - Intronic
905865378 1:41373670-41373692 CTTTGGATATTGGTTCCTCCTGG + Intronic
906134331 1:43485663-43485685 GTGTGAAGATTGGTTGAGCCTGG - Intergenic
906868078 1:49445327-49445349 TTTTAAATATTGTATCTGCCTGG + Intronic
908482998 1:64562137-64562159 GTTTAAATATTGATTCTGCTTGG + Intronic
909026941 1:70493288-70493310 GTTGTAATATTGGTTCTTTCAGG - Intergenic
909329550 1:74395428-74395450 GTTTGTCTATGGGTTCTGCAGGG - Intronic
914249449 1:145909764-145909786 GTTTGAATATTGAGACTGGCAGG - Intronic
914801914 1:150968312-150968334 GTTTGAATGTTAGCTCTGGCAGG - Intronic
916052558 1:161046535-161046557 GTTTGAAACCTGGATCTGCCTGG - Intergenic
918928887 1:190826800-190826822 GTTTGAATAGTGGTGAAGCCAGG - Intergenic
920429869 1:205911613-205911635 GTTGGAATAATGGTTCTGGGTGG + Intergenic
922355003 1:224767038-224767060 GCTTGAGTCTGGGTTCTGCCTGG + Intergenic
1064694875 10:17955136-17955158 GGTTGAATAGTAGTTTTGCCAGG + Intronic
1064803142 10:19099107-19099129 GCTTCTATATTGGTTATGCCTGG + Intronic
1065925700 10:30432923-30432945 GTTTGAATCTGGGTTGTGCCTGG + Intergenic
1069314284 10:67078360-67078382 GTGTGAATATTTGTTCTGTAAGG + Intronic
1075417881 10:122278826-122278848 GATTCAGGATTGGTTCTGCCAGG + Intronic
1076153966 10:128188565-128188587 CTTTGAATGTTGGTTCTCCGAGG + Intergenic
1078414565 11:11154897-11154919 GTTTGCAGATTTCTTCTGCCAGG + Intergenic
1079515779 11:21266645-21266667 GTTTAAATATTGGTGGTCCCCGG + Intronic
1081345203 11:41976991-41977013 GTTAGGGTATTTGTTCTGCCTGG - Intergenic
1087677483 11:101179884-101179906 TTTTGAATAATGGCTCTCCCTGG + Intergenic
1089057191 11:115595266-115595288 GTTTGAATGTTGTTTCTCCCAGG + Intergenic
1095420202 12:42017474-42017496 ATTTGAATTTGGGGTCTGCCTGG - Intergenic
1099430797 12:82583098-82583120 GTTTGTTTATTGGTTCTAACAGG - Intergenic
1101439678 12:104694219-104694241 GTTTGAATATGGGTTTTTGCTGG - Intronic
1105571307 13:21605262-21605284 GTTTGAATCTTAGCTCTACCAGG + Intergenic
1106212517 13:27663377-27663399 TTTTTAATGTTGGTTATGCCTGG - Intronic
1106986942 13:35364324-35364346 GTTTGAAGATGGGTTCTTCCAGG + Intronic
1108152249 13:47548233-47548255 CTCTGAACATTGGTTCTGCAGGG - Intergenic
1108926429 13:55752498-55752520 ATTTTATTATTTGTTCTGCCTGG - Intergenic
1109180719 13:59211458-59211480 GTTTGAATTTTGCTTTTGCTTGG - Intergenic
1115488872 14:33939503-33939525 GTTTTAAGATTGTTTCGGCCGGG - Intronic
1115890556 14:38022879-38022901 GTTAGGATATTGGTGCTTCCTGG + Intronic
1118657134 14:67964662-67964684 GTTTGACTATTGGGTGTGGCAGG + Intronic
1118745709 14:68771584-68771606 GTTTGAATCTTGCCTCTGCCTGG - Intergenic
1120582302 14:86267868-86267890 TTTGGTATTTTGGTTCTGCCAGG - Intergenic
1121014122 14:90538140-90538162 GTCTCAATCTTAGTTCTGCCAGG + Exonic
1121950344 14:98166176-98166198 GTTTGAATATTGTCTCCACCAGG + Intergenic
1122110021 14:99492997-99493019 GTTTGAATGTTGTTTCTGGTGGG + Intronic
1124148477 15:27154642-27154664 TTTTGAATATTGCATCAGCCAGG + Intronic
1124854275 15:33372172-33372194 GTTTTGATATTGTTACTGCCTGG + Intronic
1125667294 15:41441361-41441383 GTTTGAATATGTGTTATGCCTGG + Intronic
1129078965 15:73022966-73022988 GTTTAAATCCTGGCTCTGCCAGG + Intergenic
1130513206 15:84605964-84605986 GTTCAAATCTTGGTTCTGCCTGG - Intronic
1133030726 16:3009826-3009848 GCTTGAATATTGGGTCCTCCAGG - Intergenic
1134563565 16:15231579-15231601 CTTTGAAAAGTGGTTCTGGCCGG + Intergenic
1134738935 16:16525112-16525134 CTTTGAAAAGTGGTTCTGGCCGG - Intergenic
1134763919 16:16739154-16739176 GTTTGAATCATGCCTCTGCCTGG + Intergenic
1134928564 16:18187040-18187062 CTTTGAAAAGTGGTTCTGGCCGG + Intergenic
1134982135 16:18620009-18620031 GTTTGAATCATGCCTCTGCCTGG - Intergenic
1137488723 16:48913101-48913123 GTTGGAAAATTGCTTCAGCCCGG - Intergenic
1139321612 16:66118765-66118787 GTTTGAATCTCGCTTCTTCCTGG - Intergenic
1141833857 16:86525369-86525391 GTTTGAATATTGAATTGGCCTGG + Intergenic
1143286607 17:5794632-5794654 ATGGGAATATTTGTTCTGCCCGG - Intronic
1149333898 17:55614639-55614661 GTTTGAATCTTTGATATGCCTGG + Intergenic
1149815528 17:59719965-59719987 GTTTGAGTTATGCTTCTGCCCGG + Intronic
1151904377 17:77038140-77038162 GTTTGAATAATGCTACTGGCTGG + Intergenic
1152017875 17:77763783-77763805 GCTTGGAAATTGGATCTGCCAGG + Intergenic
1153726286 18:7958982-7959004 GTTTTAGTGTTGGCTCTGCCTGG + Intronic
1155859832 18:30883127-30883149 GTTTGGATATTTGTTCTGGAAGG - Intergenic
1158785539 18:60707379-60707401 GTTTTGATATTGGTTCTACAAGG + Intergenic
1159006519 18:63017824-63017846 GTTTCAATTTTGCTTTTGCCAGG - Intergenic
1159870372 18:73754661-73754683 GTTAGAATATTTGTTCTTCTTGG + Intergenic
925635926 2:5941426-5941448 GTTATAATATTGGCTCTCCCTGG - Intergenic
942144859 2:173016946-173016968 CTTTGAACATCGGTTCTGCCAGG + Intronic
944781858 2:203026958-203026980 GTTTTAATATACGTTCAGCCTGG + Intronic
945191872 2:207197045-207197067 GATTGGATATTGGTTCTGCAGGG - Intergenic
945517164 2:210776457-210776479 TTTTGAATATGGGTTGTCCCCGG - Intergenic
945824660 2:214706638-214706660 GTAGTAATATTGGTTCTGCAGGG - Intergenic
947683356 2:232057240-232057262 TCTTGAGTATTGGTTCTGGCAGG + Intronic
1169115896 20:3065650-3065672 CTTTAAATATTGGTACTGGCTGG + Intergenic
1170974411 20:21149140-21149162 GTTTGAATATTGGTTCTGCCTGG - Intronic
1171098830 20:22362140-22362162 GTTTGGTTATTAGTTCTACCAGG - Intergenic
1172623222 20:36333091-36333113 GACTGAACATTTGTTCTGCCTGG + Intronic
1178333209 21:31719419-31719441 CTTAGAAAATTAGTTCTGCCCGG - Intronic
1178853187 21:36230129-36230151 GTTTAAGAATTGTTTCTGCCAGG - Intronic
1179773665 21:43644535-43644557 GTTAGAATATTGGTTATTCAAGG - Intronic
1181103955 22:20560964-20560986 GCGTGAATATCGGTTCTGTCGGG + Intronic
1183034143 22:35128099-35128121 GTTTGAATCCTGGTTCTGGTGGG - Intergenic
1183148567 22:36018314-36018336 GTTTGGATATTGATTCCTCCTGG - Intronic
1185417579 22:50718803-50718825 GCTTGAATTTTAGATCTGCCAGG - Intergenic
949235488 3:1804345-1804367 GTTTGAAGAATATTTCTGCCAGG + Intergenic
950325306 3:12103156-12103178 GTTTGAATTCCAGTTCTGCCAGG - Intronic
952010982 3:28901126-28901148 CTTTGAATAGTGGTGCTGACAGG + Intergenic
955470051 3:59277240-59277262 GTTTGAATCCTGGTTCCACCAGG + Intergenic
966276724 3:178182047-178182069 GTATGAAGATTAGTGCTGCCTGG + Intergenic
969891101 4:10260791-10260813 GTCTGAATGTTTGGTCTGCCTGG + Intergenic
975405165 4:73980939-73980961 GTGTGAATACTGGTTATGCTTGG - Intergenic
975565649 4:75751532-75751554 GTTTAAATTTTGGTTTTGGCCGG + Intronic
979854383 4:125612965-125612987 GTTTCAATATTGGTTTTGGAGGG - Intergenic
982433438 4:155351327-155351349 GTTTTAACATTTGTTCTGCTTGG - Intronic
984463550 4:180067970-180067992 TATTGAATATTGGTTCTGTGGGG - Intergenic
986623076 5:9696115-9696137 TTTTGAATATTGACTCTACCGGG - Intronic
986846414 5:11760982-11761004 GTATGAGTATTTGTTTTGCCTGG + Intronic
987792765 5:22589344-22589366 GTTTGAAGATTGGCTCTGTTTGG - Intronic
989526962 5:42464730-42464752 TTTAGATTATTAGTTCTGCCAGG - Intronic
989954889 5:50346886-50346908 GTTTGTATATTGTTTATGGCTGG - Intergenic
990572631 5:57094499-57094521 GATAGAATCTTGGTTCTGGCAGG + Intergenic
991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG + Intronic
992969232 5:82038646-82038668 GTTAGAATATAGCTTCTGCTCGG - Intronic
993884792 5:93403194-93403216 TTTTGAATAATGGTTTTTCCAGG + Intergenic
994520194 5:100824085-100824107 GTTTGATGATTGGTTCTACTTGG + Intronic
997605490 5:135173045-135173067 GTTTGATCATTGTCTCTGCCAGG - Intronic
997628365 5:135347224-135347246 CTTTGAATGTTTGTTCTGCAGGG + Intronic
1006639579 6:35483039-35483061 GTTCAAATACTGGTTCTACCTGG - Intronic
1007078603 6:39083440-39083462 GCTTGAATATTGGTTCTGTGTGG + Intronic
1008948394 6:57125885-57125907 AATTGAATAGTGTTTCTGCCAGG - Intronic
1012149439 6:95728336-95728358 GTTTGTATATTGGTTCAACATGG - Intergenic
1015238248 6:130994981-130995003 GGATGAATATAGGTTCTGTCTGG - Intronic
1016146258 6:140678163-140678185 GTTTCAATACTGTTGCTGCCCGG + Intergenic
1016926817 6:149359273-149359295 GTTTTACTTTTGTTTCTGCCAGG + Intronic
1017097580 6:150818386-150818408 GTTTCTACATTGGTTCTCCCAGG + Intronic
1020097124 7:5375498-5375520 GTCTGAATCTTAGCTCTGCCAGG - Intronic
1020741141 7:12019801-12019823 TTTTGTATATAGGTTCTGCCAGG - Intergenic
1020799675 7:12718208-12718230 GTGGGAAGATTGGTTGTGCCTGG - Intergenic
1021563226 7:21989895-21989917 GTTTGAATGTTGGTTCTATAGGG - Intergenic
1022163537 7:27735741-27735763 GTTTGAAAAATAGTTCTGCTGGG + Intergenic
1024386256 7:48755194-48755216 GTTTGAACAAAGGTTCTGCGAGG + Intergenic
1027695220 7:81402320-81402342 GTTTGCATATTACTTCTTCCTGG + Intergenic
1030988337 7:116268839-116268861 GTTTGAAGATTTGTTCACCCAGG - Intergenic
1031293877 7:119977095-119977117 GTTTGAAAAATGGTTCTTCCCGG + Intergenic
1031407053 7:121398310-121398332 GTTTGAATCTTAGCTCTGTCTGG - Intergenic
1034878177 7:154743691-154743713 GTTTGAATTTTGGTAATGCAGGG - Intronic
1035840325 8:2805101-2805123 GTTTGAATATTGGATCCCACTGG + Intergenic
1036946408 8:13099190-13099212 CTTTGAATTTTGGTGCTTCCTGG + Intronic
1039250094 8:35654040-35654062 ATTTGTAAATTGTTTCTGCCAGG + Intronic
1041503028 8:58560017-58560039 GCTTGAATATAAGTTCTGACAGG + Intronic
1047289704 8:123519118-123519140 GTCAGAATATATGTTCTGCCAGG - Intronic
1047501706 8:125446697-125446719 GTTTGAAAATGGGTTTTGCTGGG - Intergenic
1051071935 9:13180363-13180385 TCTTGAATATCAGTTCTGCCAGG - Intronic
1055167492 9:73214773-73214795 GTTGTAAAATTGGTTATGCCTGG - Intergenic
1058352295 9:104040090-104040112 GTGAGATTATTGTTTCTGCCAGG - Intergenic
1059902764 9:118946602-118946624 ATTTGAATTTGGGTTCTGCAGGG + Intergenic
1188843698 X:35047189-35047211 GTTGGAAAATTGTTGCTGCCAGG - Intergenic
1188854509 X:35176848-35176870 GTTTTCATATTGGTTATGCATGG + Intergenic
1189895989 X:45657360-45657382 GTTTAGAAATTGCTTCTGCCAGG - Intergenic
1196249230 X:113439677-113439699 GTTTGAATAATATTTTTGCCAGG - Intergenic