ID: 1170977155

View in Genome Browser
Species Human (GRCh38)
Location 20:21175708-21175730
Sequence GCCTCCTAGAGACTTAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170977155_1170977162 22 Left 1170977155 20:21175708-21175730 CCTTAGTTAAGTCTCTAGGAGGC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1170977162 20:21175753-21175775 CCTATAATCCCCAACACTTTGGG 0: 3
1: 63
2: 393
3: 803
4: 1406
1170977155_1170977160 21 Left 1170977155 20:21175708-21175730 CCTTAGTTAAGTCTCTAGGAGGC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1170977160 20:21175752-21175774 GCCTATAATCCCCAACACTTTGG 0: 3
1: 48
2: 332
3: 1097
4: 9312
1170977155_1170977163 25 Left 1170977155 20:21175708-21175730 CCTTAGTTAAGTCTCTAGGAGGC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1170977163 20:21175756-21175778 ATAATCCCCAACACTTTGGGAGG 0: 2
1: 63
2: 414
3: 936
4: 3615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170977155 Original CRISPR GCCTCCTAGAGACTTAACTA AGG (reversed) Intronic
902230792 1:15026190-15026212 GCCTCCTAGAGCCTGAGCTCAGG + Intronic
906910709 1:49945806-49945828 GCCTTCAAGAGACTCAAGTAAGG + Intronic
908185721 1:61651045-61651067 GACTCCTAGACACATAACTGTGG - Intergenic
912744041 1:112230356-112230378 GCGTCCTAGACACTCAGCTAGGG - Intergenic
913581484 1:120231860-120231882 GCCTCCTAGGCATTTAACTCAGG - Intergenic
913626692 1:120666528-120666550 GCCTCCTAGGCATTTAACTCAGG + Intergenic
914563416 1:148843306-148843328 GCCTCCTAGGCATTTAACTCAGG - Intronic
914609411 1:149286917-149286939 GCCTCCTAGGCATTTAACTCAGG + Intergenic
914989306 1:152484771-152484793 CCCTCTTAGAGACTTCCCTATGG - Intergenic
915641206 1:157228277-157228299 GACTCCTAGAAACATTACTAAGG + Intergenic
915668275 1:157464664-157464686 GACTCCTAGAAACATTACTAAGG - Intergenic
918745629 1:188195087-188195109 ACCTCCTAGAGACTGACCTTAGG - Intergenic
920172065 1:204078349-204078371 GCTTCCTGGAGACTTACCCAGGG - Intronic
920580998 1:207107589-207107611 GCCTCCTTGAGACTGAAGCATGG + Intronic
920718607 1:208365812-208365834 GTCTCCTAGAGAATCAACCATGG + Intergenic
921112905 1:212055908-212055930 TCCTCCTAGAGTCTAAACTTGGG + Intronic
922950137 1:229552381-229552403 GCAAGCAAGAGACTTAACTATGG - Intronic
1066455807 10:35570622-35570644 GCCTCCCAGAGACTTGAAAAGGG - Exonic
1068582022 10:58752617-58752639 GCCTCTAAGATACTCAACTAAGG - Intronic
1071374089 10:84984889-84984911 TCCTCCTAGAGTCTTAAACACGG + Intergenic
1077925739 11:6680710-6680732 GACTCCTAGATACCTAGCTAGGG + Intergenic
1085569684 11:77548454-77548476 GCCACCTAGAGGCTTACTTATGG + Intronic
1086558828 11:88143780-88143802 GCCTTCTACAAACTGAACTATGG + Intronic
1086995840 11:93354345-93354367 ACCTCCTAGAGACTTGTCAATGG - Intronic
1087919527 11:103850301-103850323 CCCCTCTAGAGACTTGACTAGGG + Intergenic
1088001506 11:104887361-104887383 GACTCCTGGAGACATAACTTTGG + Intergenic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1099742853 12:86663581-86663603 GCCATCTAGACCCTTAACTATGG + Intronic
1100427876 12:94504044-94504066 GCCTCCTAGAAACTGATCAAGGG - Intergenic
1102992546 12:117325371-117325393 GCCTCCTAGGGGCTGAAATAAGG - Intronic
1108904224 13:55449536-55449558 GACCCCTAGAAATTTAACTAAGG - Intergenic
1115348455 14:32367249-32367271 GCCTCCTGGAGTCTTAACGCAGG + Intronic
1115534828 14:34363235-34363257 ACCTCCTACAGACATAACTAAGG - Intronic
1117661186 14:58006542-58006564 GCCTCCCAGAGTCTTCACTTAGG + Intronic
1119790402 14:77344942-77344964 GGCTGTTAGAGACTTTACTAAGG - Intronic
1122192559 14:100057771-100057793 GACTCCTAGAACCTCAACTATGG - Intronic
1124955632 15:34358411-34358433 GCCCCCTAGAGACACAATTATGG - Intergenic
1125233542 15:37484818-37484840 ACTTCCTAGAGACTTAAGAATGG - Intergenic
1125249922 15:37689140-37689162 GCCTCCTGAAGACTTAATTGTGG + Intergenic
1129635134 15:77307937-77307959 TCTTCCTTTAGACTTAACTATGG + Intronic
1135799513 16:25479492-25479514 GCCTCCTAGGTTCTTAACTCTGG + Intergenic
1141119188 16:81337917-81337939 GAGTCCTAGAGGCTTAACTCTGG - Intronic
1144305482 17:13966111-13966133 TCCTCCCAGAGATTTACCTAAGG + Intergenic
1147784438 17:42968960-42968982 TCCTCCTAGGCACTTGACTATGG - Exonic
1153068413 18:1075997-1076019 GCATCCTAGAGACTTGGCAAAGG + Intergenic
1155623553 18:27808780-27808802 TCCTCCTAGAGTTTGAACTAGGG + Intergenic
1156566606 18:38198361-38198383 GCCTCCTAAAGATGTAATTAAGG - Intergenic
1159147050 18:64467897-64467919 GACTGCTACAGACTTAACCAAGG + Intergenic
925670062 2:6301647-6301669 CAGTCCTAGAGACTTAGCTAAGG + Intergenic
927031453 2:19124431-19124453 TCCTCCTCGAGCCTTAGCTAAGG - Intergenic
934720973 2:96576533-96576555 GCCTACTAGATAATTACCTAGGG + Intergenic
941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG + Intronic
941690300 2:168494604-168494626 GCCCCCTATCGACTTCACTAGGG + Intronic
943404872 2:187469134-187469156 GCCTTCTAGATATTTAAATAAGG + Intronic
946412981 2:219524676-219524698 GAATCCCACAGACTTAACTAAGG + Intronic
947976851 2:234374083-234374105 GTCTCCTTGAGACTTAAATGAGG + Intergenic
1170977155 20:21175708-21175730 GCCTCCTAGAGACTTAACTAAGG - Intronic
1175022742 20:55868292-55868314 GCATCCCAGAGACTTTGCTATGG - Intergenic
1175194733 20:57235096-57235118 GCCTCCATGAGACCTGACTATGG + Intronic
1176058835 20:63163118-63163140 GCCTCCTAGTGGCTTCACCAGGG + Intergenic
1182163791 22:28151339-28151361 GCCTGCTGGAGACACAACTATGG + Intronic
1182576211 22:31274810-31274832 ACCTCATAGAGCCTTAACTCTGG + Intronic
951551030 3:23875366-23875388 ACCCCCTAGAGACTTAAATTCGG + Intronic
953781487 3:45874930-45874952 GCCAGCTAGAAAGTTAACTAGGG - Intronic
960007268 3:112793270-112793292 CCCTCCTTGAGAGTTAACCAGGG + Intronic
961374724 3:126456687-126456709 TCCTTCTAGAGAATTACCTAAGG + Intronic
970922410 4:21410594-21410616 GCCACCTACAGGCTTAACTGTGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
981260977 4:142718455-142718477 CCCTTCTAGAGAGTTAAGTATGG + Intronic
982597842 4:157407469-157407491 GGCCCCTAGAGACTTTACTGAGG + Intergenic
983927302 4:173415977-173415999 GCCTCCTAGAGACTTGCCAGTGG - Intergenic
988258129 5:28848119-28848141 GCGTCCTAGAAACTTCACTGAGG - Intergenic
989326435 5:40201396-40201418 GCCTCCTAGAGTTCTGACTATGG + Intergenic
1001849221 5:174949101-174949123 GCCTCCTATGCACTTAGCTATGG - Intergenic
1002831618 6:826980-827002 TACTCCTAGAAACTTCACTAAGG - Intergenic
1006813908 6:36838392-36838414 GCCACAGAGAGACTGAACTAGGG + Intronic
1006917143 6:37602025-37602047 GCTGCCAAGTGACTTAACTATGG + Intergenic
1009778283 6:68234784-68234806 GCTTCCTGGAGACTTTAGTAAGG + Intergenic
1010369005 6:75085758-75085780 GGCTCCTAGAAACTGAACTCGGG + Exonic
1013455982 6:110330091-110330113 GCCTCCTGGAGCCTGAACTGCGG - Intronic
1022492138 7:30829028-30829050 GCCTCTTAGTAAGTTAACTAAGG + Intronic
1024419813 7:49151207-49151229 GCCTGCTTGAGAATTAAATAAGG - Intergenic
1028725874 7:94087406-94087428 ACCTCTTAGAGACTTTAATACGG + Intergenic
1035098108 7:156373188-156373210 GCCTCCCAGAGACTCAGCTAGGG - Intergenic
1037534460 8:19811823-19811845 GTCTCCTGGAGGCTTAATTATGG + Intergenic
1040514220 8:48121317-48121339 TCCTCCTAGTGACTAAACTGGGG - Intergenic
1042761680 8:72277975-72277997 GCAGCCTAGAAACTTAACCATGG - Intergenic
1047136938 8:122089875-122089897 GCTTCCCAGAGCATTAACTAAGG - Intergenic
1050828708 9:9983931-9983953 CCCTCTTAGAGACATAACTAAGG + Intronic
1052278207 9:26702640-26702662 GCTTCCCAGAGACTCAATTAAGG + Intergenic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1061271967 9:129548849-129548871 GCCTCCTGGACACTTAGCTCAGG + Intergenic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1194957465 X:100197804-100197826 GCCTACTAGAGTCATATCTAGGG - Intergenic
1195394159 X:104393081-104393103 GCCTCCTGGAGCCTAAAGTAAGG - Intergenic
1199009187 X:142739085-142739107 ACATCCTAGAGGCTTAACTGGGG + Intergenic
1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG + Intergenic
1199371667 X:147056892-147056914 GCCTCCTAGAAATTTCACTTGGG + Intergenic