ID: 1170978288

View in Genome Browser
Species Human (GRCh38)
Location 20:21187369-21187391
Sequence TCATCTGAGTGCCCCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170978278_1170978288 16 Left 1170978278 20:21187330-21187352 CCCGAGCAAAGTCAGAACCCAGG 0: 1
1: 0
2: 0
3: 12
4: 206
Right 1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 118
1170978284_1170978288 -2 Left 1170978284 20:21187348-21187370 CCAGGATGGGACCTGCCCTACTC 0: 1
1: 1
2: 0
3: 11
4: 148
Right 1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 118
1170978283_1170978288 -1 Left 1170978283 20:21187347-21187369 CCCAGGATGGGACCTGCCCTACT 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 118
1170978277_1170978288 17 Left 1170978277 20:21187329-21187351 CCCCGAGCAAAGTCAGAACCCAG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 118
1170978280_1170978288 15 Left 1170978280 20:21187331-21187353 CCGAGCAAAGTCAGAACCCAGGA 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170978288 Original CRISPR TCATCTGAGTGCCCCCTCAG TGG Intronic
900544311 1:3220049-3220071 TCCTCTGAGAGCCCACTCGGGGG - Intronic
902271588 1:15308892-15308914 GAATCTGAGTTCACCCTCAGAGG + Intronic
902939188 1:19787477-19787499 TTTTCTGAGTGCCCACTCTGTGG - Intronic
903287625 1:22286628-22286650 CCAACTGAGGGCCCCCTCACTGG - Intergenic
904532392 1:31177795-31177817 AGATCTGAGTGCCCCAGCAGAGG - Intergenic
904895988 1:33818964-33818986 TCTTTTGAGTGCCCCTTTAGAGG - Intronic
906931289 1:50172015-50172037 CCATCTGGCTGCCTCCTCAGGGG + Intronic
908050913 1:60229487-60229509 TCACCTGACTGCCTCCTCACTGG + Intergenic
910519617 1:88105059-88105081 ACCTCTGAGTGCCCTCTCTGTGG - Intergenic
913029987 1:114892259-114892281 TCACCTGAGTGCTCCATCAGGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
915952931 1:160201933-160201955 ACATCTGAATTCCCCATCAGTGG - Intergenic
923978313 1:239290345-239290367 GCATTTGAGTGCTGCCTCAGAGG - Intergenic
1067737389 10:48868630-48868652 TCATCTTATTTCCCCCTCAGTGG - Intronic
1070661902 10:78312748-78312770 TCATCTGAGACCCACCACAGAGG - Intergenic
1072058673 10:91787461-91787483 TCATCTCAGTGCTGCCTCTGTGG - Intergenic
1076649748 10:131979797-131979819 TCCTCTGAGTGTACCCTCTGGGG - Intronic
1091112901 11:132987196-132987218 TCATCTCATTGCCCTCTCAGTGG - Intronic
1091320515 11:134646137-134646159 TCCTCCGTGTGCCCTCTCAGAGG + Intergenic
1091336088 11:134767372-134767394 TCATCTAAATGCCCCTTCTGCGG - Intergenic
1092008113 12:5086702-5086724 TCATCTTAGTGCCCACTCCTGGG - Intergenic
1094057042 12:26278369-26278391 TCCTCTGAATGTGCCCTCAGAGG - Intronic
1094375266 12:29783191-29783213 TCAACTGTCTGCCCTCTCAGCGG - Intronic
1097757685 12:63425399-63425421 CCATCTGAGTGACCCCGTAGTGG - Intergenic
1098097079 12:66969813-66969835 TCTTCTGAGTGACCCTTCAGAGG + Intergenic
1100403749 12:94254582-94254604 TCTTCAGAGTGACCCCTCACTGG + Intronic
1101674746 12:106907732-106907754 TCCTCTTTGTGCCCCCTCACTGG - Intergenic
1101948597 12:109156951-109156973 TCCACTTAGTGCCCCCACAGTGG - Intronic
1105637032 13:22225553-22225575 TCATCAGACAGCCTCCTCAGTGG - Intergenic
1106024978 13:25947872-25947894 ACATCTGAGTGCGTCTTCAGTGG + Intronic
1106521920 13:30505845-30505867 TCCTCAGACTGCCCCCTGAGAGG - Intronic
1106700143 13:32220452-32220474 TCCTTTGTGTGTCCCCTCAGGGG + Intronic
1111292232 13:86185293-86185315 CCATCTGTGTGCTCCCTTAGAGG + Intergenic
1111349809 13:87013295-87013317 TCACCTCAGTGCTTCCTCAGTGG - Intergenic
1113185241 13:107680000-107680022 ACATCTGAGTGTCCCTTCGGTGG + Intronic
1116049108 14:39781605-39781627 TCCTCTGACTGCCCTCCCAGTGG + Intergenic
1119145854 14:72313409-72313431 TCTACTGAGTGCCCACTAAGTGG - Intronic
1122144165 14:99679268-99679290 ACATGTGAATGCTCCCTCAGCGG - Exonic
1122391866 14:101394929-101394951 TCATCTGAGAAACTCCTCAGAGG + Intergenic
1125446952 15:39768118-39768140 TCATCTGCCTGCCCCCTCTAGGG + Intronic
1125605745 15:40938781-40938803 GCACCTGATTTCCCCCTCAGTGG - Exonic
1127360888 15:58244319-58244341 TCATCTGTTTGTCCCCTGAGTGG + Intronic
1131822318 15:96285704-96285726 CCATCTGCGTTGCCCCTCAGAGG + Intergenic
1132376769 15:101333358-101333380 TCAGCTGTGAACCCCCTCAGTGG + Intronic
1132660874 16:1061008-1061030 TCATCTGACTGCTCCCTGGGAGG - Intergenic
1133932373 16:10242869-10242891 TCATCAGTGTGCCCATTCAGAGG + Intergenic
1137811449 16:51356705-51356727 AAATCTGAGTGACACCTCAGAGG - Intergenic
1138351729 16:56349545-56349567 TCATCTGTGTGATCCCTCCGGGG - Intronic
1141606596 16:85157523-85157545 TTTACTGAGTGCCCCCTAAGTGG + Intergenic
1143620506 17:8077545-8077567 TGATCTGCCTGCCCCCTGAGGGG - Intronic
1143777876 17:9211303-9211325 TCATCTGAGTGTCACCTCCTGGG + Intronic
1144876557 17:18400162-18400184 TCAAATGAGTGCCCCCTATGAGG + Intergenic
1145155669 17:20544258-20544280 TCAAATGAGTGCCCCCTATGAGG - Intergenic
1147864451 17:43543502-43543524 TCAGCTGAGAGTCCCCACAGTGG - Intronic
1152382635 17:79950067-79950089 TAATCTGAGCGCCACCCCAGGGG - Intronic
1152750518 17:82060472-82060494 TCAGCTGTGTCCTCCCTCAGTGG - Intronic
1153812245 18:8762482-8762504 TCATTTGAGAGCCTCCTTAGTGG - Intronic
1157547275 18:48555362-48555384 TCATCTGAGTCCCCTTTGAGTGG + Intronic
1157637067 18:49169156-49169178 TCACCTGACTGCGCCCTCTGGGG - Intronic
1157732077 18:50012705-50012727 GCATCTGGGTGCCCCTTCTGTGG + Intronic
1160399907 18:78602591-78602613 GCATCTTTGTGCTCCCTCAGAGG + Intergenic
1164425561 19:28138493-28138515 TCACCTGAGTGCCCCCCAGGAGG + Intergenic
1167352823 19:48986238-48986260 TCAAGTGACTGCCTCCTCAGGGG + Intronic
1168458476 19:56534203-56534225 TCACCTGAGTGCCCTCCCAGTGG + Intergenic
926272382 2:11376390-11376412 TCAGATCAGTGCCCCCCCAGGGG - Intergenic
932668809 2:73719264-73719286 ACTTCAGAGTGCCCCCTCTGTGG - Intergenic
938409574 2:131052906-131052928 ACAGCTATGTGCCCCCTCAGTGG - Exonic
939538188 2:143459521-143459543 GCATGTGTGTGCCCACTCAGGGG + Intronic
944388261 2:199188695-199188717 TCTTCTGAGAGCCCTCTCATTGG + Intergenic
945393750 2:209296830-209296852 TCATCTGATTGCCCCCTAAAAGG - Intergenic
1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG + Intronic
1173337189 20:42122368-42122390 TCATCCCAGTGTCCCCTGAGAGG - Intronic
1173702734 20:45087286-45087308 TTCTCTGAGAGCCTCCTCAGTGG - Intergenic
1173709688 20:45143711-45143733 TCATCTAAATGCGCCCTCCGTGG + Intergenic
1174181202 20:48676174-48676196 TCAGGTGAGGGCCTCCTCAGGGG - Exonic
1174753691 20:53137588-53137610 TCATTTGAGGGCCACTTCAGAGG - Intronic
1175416129 20:58802700-58802722 TAAGCTGTGTGCCCCCACAGAGG + Intergenic
1178795553 21:35741091-35741113 TCATCTGTGAGCCCTGTCAGTGG + Intronic
1181596067 22:23915603-23915625 GCATCAGAGTTCCCTCTCAGAGG + Intergenic
1184407225 22:44307062-44307084 TCATTTGTGGGGCCCCTCAGGGG - Intronic
1185128987 22:49026914-49026936 TCTGCTGAGTGCCCCAGCAGTGG + Intergenic
951928082 3:27932075-27932097 TCAGCTCTGTGCCTCCTCAGTGG - Intergenic
952311266 3:32192536-32192558 TCATCTGAATGCCCTCTCAGTGG - Intergenic
952691536 3:36211909-36211931 AAATCTGAGAGCCCCCACAGAGG - Intergenic
954701676 3:52453931-52453953 TCAGCTGAGTGAGCCCCCAGTGG + Intronic
955745260 3:62134239-62134261 TCATCTGACTTCCCACTTAGAGG - Intronic
957341663 3:78906299-78906321 TCATCTGTGAGCCACCTCAATGG + Intronic
962078818 3:132115102-132115124 TCATCTAAATGCTCCCTCTGTGG + Intronic
966470434 3:180282863-180282885 TCATCTCAGTTCCCAGTCAGAGG + Intergenic
969255896 4:6001579-6001601 TCATCTGCTTGCCGCCTCACAGG + Intergenic
969262141 4:6040808-6040830 TCATCTGAGTGCCCCCAATTCGG - Intronic
969331874 4:6478390-6478412 TCTTCTGAGTGCAGCTTCAGTGG + Intronic
969719836 4:8887548-8887570 TGATCTCAGTGCCCTCTGAGGGG + Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
971928834 4:33051392-33051414 TTATCTAAGTTCCCCCTCAAGGG - Intergenic
974409185 4:61517256-61517278 TCACCTCAGTCCCGCCTCAGGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977074322 4:92433460-92433482 TCATCTAAGTGCTTCCTCTGTGG + Intronic
981844921 4:149156475-149156497 TCATCTGAGTGTCCTATCAGGGG - Intergenic
982017900 4:151174197-151174219 TCATCTGAGGAGCCCCTCTGGGG + Intronic
983884545 4:172965668-172965690 ACATCTTAGTGCCCCAACAGTGG + Intronic
984880813 4:184408624-184408646 TCTTTTGAGCACCCCCTCAGAGG - Intronic
986207872 5:5643231-5643253 TCATCTGAGTGACACCTCATTGG + Intergenic
987614761 5:20259207-20259229 TCCTCTGAGCCCTCCCTCAGAGG - Intronic
1001885760 5:175288749-175288771 TTTTCTGAGTGCCCCCTATGTGG + Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1018960344 6:168442921-168442943 TCCTCTGAGGGCCCCCTCTGGGG - Intronic
1023105937 7:36763394-36763416 TCATCTCAGTCCCCACTCAGAGG + Intergenic
1024686963 7:51756552-51756574 TCATCTGAGTGCTTCCTTGGTGG + Intergenic
1024802415 7:53095919-53095941 TGATAGGAGTGACCCCTCAGTGG + Intergenic
1025718095 7:63982681-63982703 TAGTCTGAGTGCTCCCTCTGGGG - Intergenic
1025799933 7:64776487-64776509 TCATTTGAGTGCCCATTCTGAGG + Intergenic
1029199165 7:98827207-98827229 TCATCAGAATGGCCCATCAGGGG + Intergenic
1030960398 7:115913176-115913198 TCATTTGAGTGCCACTTCAATGG - Intergenic
1033896742 7:146080775-146080797 TCATCTGAGAAACACCTCAGTGG + Intergenic
1037905763 8:22715283-22715305 TCACCTGAGTGTCCTTTCAGAGG + Intronic
1041087232 8:54268232-54268254 GCATCTGAGTGGGCCCTCACTGG - Intergenic
1041216730 8:55608229-55608251 TCATCTCAGTACCTCCTCAAAGG + Intergenic
1051382662 9:16473966-16473988 TCACATGACTGCCCCCTGAGTGG - Intronic
1056702721 9:88924331-88924353 TCATGTGTGTGACCCCCCAGAGG - Intergenic
1059123629 9:111663196-111663218 GCATCTGCGTGCCTGCTCAGGGG - Intronic
1061644011 9:131984376-131984398 TCATCTGAGTGCCTGCTAAATGG - Intronic
1062044959 9:134420721-134420743 TCAGATGACGGCCCCCTCAGTGG - Intronic
1185469667 X:374844-374866 TCCTCTGCGTGACCCCACAGTGG - Intronic
1188651411 X:32635054-32635076 TCATCTAAATGCTCCCTCTGCGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1194270093 X:91802159-91802181 CAATCTGTGTTCCCCCTCAGGGG + Intronic
1196357462 X:114810480-114810502 TCATCTAAATGCTCTCTCAGTGG + Intronic
1200153981 X:153965537-153965559 TCCTCTGAGGGACCCCTCATAGG - Intronic
1200587333 Y:5023598-5023620 CAATCTGTGTTCCCCCTCAGTGG + Intronic