ID: 1170979198

View in Genome Browser
Species Human (GRCh38)
Location 20:21195394-21195416
Sequence GTTGTCACCATTCCTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170979195_1170979198 1 Left 1170979195 20:21195370-21195392 CCACTAAAAGTCAGTCTGCCTTC 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1170979198 20:21195394-21195416 GTTGTCACCATTCCTAAGGATGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170979198 Original CRISPR GTTGTCACCATTCCTAAGGA TGG Intronic
902113721 1:14104069-14104091 ATTGGCACCATGCCAAAGGAAGG + Intergenic
908742109 1:67339534-67339556 TTTATTACCATTCCTGAGGAAGG - Intronic
912623757 1:111191187-111191209 GTACTCAGCAGTCCTAAGGAAGG + Intronic
913279821 1:117175033-117175055 TCTGTCTCCATTCCTGAGGAGGG + Intronic
918294821 1:183146562-183146584 GTTGTAACAATTCCTAAGATTGG - Intergenic
920128175 1:203710417-203710439 GTTGGCACTATACCTAAGTAGGG + Intronic
920557799 1:206916813-206916835 GTAATCACCTTTCCTAAGAACGG - Intronic
923434846 1:233958048-233958070 TTCTTCACCATTCCAAAGGAAGG + Intronic
1070233833 10:74602586-74602608 CTTGTAAGCATTCCTAAGAATGG - Intronic
1074987929 10:118673798-118673820 TTTGTCACTTTTCCCAAGGATGG - Intergenic
1083302378 11:61745762-61745784 GTGTGCACCGTTCCTAAGGAAGG + Exonic
1084440411 11:69169563-69169585 ATTGTCTCCATTGTTAAGGATGG + Intergenic
1084842155 11:71863183-71863205 CTTGCCACCATGCCTAGGGAAGG - Intergenic
1088776279 11:113086557-113086579 CTTGTAAACATTCTTAAGGAAGG + Intronic
1093512102 12:19941521-19941543 GATGTAACCATTACTAATGATGG + Intergenic
1109192645 13:59344101-59344123 GTTGTCACTTTTCCTAATAAAGG - Intergenic
1112199082 13:97257975-97257997 GTTGTCATCATTTCTAAGCAAGG - Intronic
1116059035 14:39897895-39897917 TATGGCACCATTCCTAAGGGTGG + Intergenic
1116599223 14:46897844-46897866 ATTGTCACTATTTCTAAGCAAGG - Intronic
1120645493 14:87069473-87069495 GTATTCACCATACCTAATGAAGG + Intergenic
1128366061 15:67004118-67004140 GTTGTCATCATTATTTAGGAAGG + Intergenic
1131868102 15:96733274-96733296 GTAGGCACAATTCCGAAGGAAGG - Intergenic
1133575368 16:7083862-7083884 AGAGTCACCATTCCTCAGGATGG - Intronic
1135074335 16:19380582-19380604 GTTTTCACATTTGCTAAGGAAGG + Intergenic
1139095846 16:63703824-63703846 GATGTCAGCATTTCTCAGGATGG + Intergenic
1140268388 16:73440622-73440644 GTTGGAACCATTACTAAGGTAGG - Intergenic
1143755237 17:9062220-9062242 GTTGTCCCAATTCCGAATGAGGG + Intronic
1144947926 17:18979246-18979268 GCTGGCCCCATCCCTAAGGACGG + Intronic
1146706084 17:35001746-35001768 CTTGGCACCATTCCAAAGTATGG - Intronic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1158875667 18:61732501-61732523 GTTGTCTTCATTTATAAGGAAGG + Intergenic
1162311435 19:9909761-9909783 GTTCTCCCCAGTCCTGAGGAAGG + Intronic
926351080 2:11994989-11995011 GTTGTCACCATTCTAGAGGCTGG - Intergenic
928871543 2:35986976-35986998 GTTGGCACCATTCATCAGAATGG + Intergenic
930880733 2:56267237-56267259 GTTCTCACCATCCCTAGCGAAGG + Intronic
932112633 2:69014331-69014353 GTTGTCACCACTAATAAGGAAGG - Intronic
935395976 2:102609667-102609689 CATGTCACCCTTCCTAGGGATGG + Intergenic
936714191 2:115164829-115164851 GTTGTCACCATTCTCTAGGGAGG - Intronic
937145208 2:119638642-119638664 TTTGTCAACATTCCTCTGGAAGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947845470 2:233240143-233240165 GATGACACCATCCCTAAGAAGGG + Intronic
1169560915 20:6799861-6799883 GGTGTCATCATTCCAATGGAAGG + Intergenic
1170130187 20:13010884-13010906 GTTATAACCACTCCTAAGTAAGG + Intronic
1170499100 20:16956395-16956417 GTTTTCTCTTTTCCTAAGGATGG + Intergenic
1170979198 20:21195394-21195416 GTTGTCACCATTCCTAAGGATGG + Intronic
1183526389 22:38325782-38325804 TTTGTCACCCTTCCTCTGGAGGG + Intronic
1183924776 22:41197800-41197822 GTTGTCTCCCTTCCTTCGGATGG + Intergenic
1185109703 22:48894129-48894151 GTGGTGACCGTTCCTGAGGATGG - Intergenic
951506886 3:23457060-23457082 GTTTTCACCATTGTTCAGGAAGG - Intronic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
956938140 3:74127132-74127154 GTTGCCACCATTCCTTAGAATGG - Intergenic
958949913 3:100405464-100405486 TTTCTCACAATTCCTGAGGATGG + Intronic
960268354 3:115647289-115647311 TTTCTCACCATTCCAGAGGATGG - Intronic
960789595 3:121413811-121413833 GTTGTGACCATTCTTACAGAAGG - Intronic
964517957 3:157533278-157533300 CTTCTCACCAACCCTAAGGAAGG + Intronic
964744313 3:159997991-159998013 GTAGTCACCATTCCAAGTGAGGG - Intergenic
969783263 4:9429226-9429248 CTTGCCACCATGCCTAGGGAAGG - Intergenic
970651899 4:18187934-18187956 GTTGTCACACTTTCTGAGGATGG - Intergenic
972762550 4:42121402-42121424 GTGGTTTCCTTTCCTAAGGAAGG + Intronic
976296070 4:83473638-83473660 GTAGTCCCCATTACTAGGGAGGG - Intronic
978335195 4:107659808-107659830 TATGTCACAATTTCTAAGGATGG - Intronic
980136661 4:128864765-128864787 GTTGTCTGCATTTCTAATGATGG - Intronic
983037602 4:162886558-162886580 CTGATCAACATTCCTAAGGAAGG + Intergenic
986431185 5:7682749-7682771 GCTGCCAGCATTCTTAAGGATGG + Intronic
989451091 5:41587609-41587631 GATGTAACCATTACTAATGATGG - Intergenic
992357369 5:75999919-75999941 GATGTTAACATTCATAAGGATGG + Intergenic
992891369 5:81207403-81207425 GTTGACATTATTCCTAAGGCAGG + Intronic
993177870 5:84511544-84511566 GTTGTCAGAATTACTAAAGAGGG - Intergenic
999221083 5:149978226-149978248 TTTGAAACCATTCCTAAGGAAGG - Exonic
1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG + Intergenic
1003570573 6:7253893-7253915 AATTTCACCATTCCTAAGAAAGG + Intergenic
1006248271 6:32758956-32758978 CCAGTCACCATTCCTAATGAGGG + Exonic
1008090703 6:47291068-47291090 TTTGTCACCACTCTTAAGGATGG + Intronic
1012219724 6:96634183-96634205 ATTGGTACCATTCCTATGGAGGG - Intergenic
1012510762 6:99999168-99999190 TTTCTCATAATTCCTAAGGATGG - Intergenic
1015286598 6:131492363-131492385 AATGTCACCATTCCTAAATAGGG - Intergenic
1017847219 6:158269456-158269478 GATTTCTCCATTACTAAGGAAGG - Intronic
1018023654 6:159787849-159787871 GATGTAACCATTACTAACGATGG - Exonic
1020502309 7:8938832-8938854 GTTGACATCACTCTTAAGGAAGG + Intergenic
1022202194 7:28127401-28127423 ATTGTCACCATTCCCAATGCAGG - Intronic
1022958801 7:35405306-35405328 GTTGTCAGGCTTCCAAAGGAAGG - Intergenic
1029595582 7:101535906-101535928 GTTGTCTGCATTTCTAAGTAGGG + Intronic
1032565689 7:132940560-132940582 GTGGTGAATATTCCTAAGGACGG - Intronic
1035092679 7:156327561-156327583 GGTGTCACCAGTCCTAGGAAGGG - Intergenic
1036835791 8:12064845-12064867 CTTGCCACCATGCCTAGGGAAGG + Intronic
1036857634 8:12311418-12311440 CTTGCCACCATGCCTAGGGAAGG + Intergenic
1038039286 8:23710311-23710333 GATGTCTCCATTCCTGAGTAAGG - Intergenic
1040689545 8:49919006-49919028 GTTGTCTTCATTCCAAAGTACGG + Intronic
1045407217 8:101879240-101879262 GGTGTTACAATTCCTAAAGATGG + Intronic
1046684878 8:117213866-117213888 GTGTTTACCAGTCCTAAGGAGGG - Intergenic
1047159763 8:122364950-122364972 GTTTTCACCATTATTCAGGAGGG - Intergenic
1048271821 8:133034883-133034905 CTTGTAACCATACCTAAAGAGGG - Intronic
1049271036 8:141696405-141696427 GTTGTCACCCATCCTACGGGAGG - Intergenic
1060617049 9:125026590-125026612 GATGTCACAATGCCAAAGGAGGG - Intronic
1061887253 9:133598051-133598073 GTTGTCACCATGGCTCAGGTTGG - Intergenic
1195968973 X:110454032-110454054 GGGGTCAACATTCCGAAGGATGG - Exonic
1199697122 X:150350657-150350679 GGTTTTACCAATCCTAAGGATGG - Intergenic