ID: 1170979220

View in Genome Browser
Species Human (GRCh38)
Location 20:21195554-21195576
Sequence CAGGATGCAAACCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 249}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170979220_1170979226 -9 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979226 20:21195568-21195590 TGCATCCTGGTTTGGGAAGTGGG 0: 1
1: 0
2: 1
3: 23
4: 190
1170979220_1170979228 -1 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979228 20:21195576-21195598 GGTTTGGGAAGTGGGACTAAAGG 0: 1
1: 0
2: 2
3: 14
4: 202
1170979220_1170979229 0 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979229 20:21195577-21195599 GTTTGGGAAGTGGGACTAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 184
1170979220_1170979231 27 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979231 20:21195604-21195626 TAAGCTTGGAGATCATAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 72
1170979220_1170979225 -10 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979225 20:21195567-21195589 TTGCATCCTGGTTTGGGAAGTGG 0: 1
1: 0
2: 2
3: 15
4: 255
1170979220_1170979232 30 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979232 20:21195607-21195629 GCTTGGAGATCATAAGCTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 97
1170979220_1170979230 13 Left 1170979220 20:21195554-21195576 CCTTGCTCCAGGTTTGCATCCTG 0: 1
1: 0
2: 4
3: 18
4: 249
Right 1170979230 20:21195590-21195612 GACTAAAGGGAATCTAAGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170979220 Original CRISPR CAGGATGCAAACCTGGAGCA AGG (reversed) Intronic
900115301 1:1025589-1025611 CAGGATGAGAACCTGGAGTCAGG - Intronic
902422327 1:16290754-16290776 CAGTCTGCAAACCAGGAGCTGGG + Intronic
903755586 1:25658279-25658301 CAGGTTGTGAACCTGGAGCCAGG + Intronic
904643990 1:31952234-31952256 CAGGCTGAAAAGCTGGGGCAAGG - Intergenic
904893270 1:33795100-33795122 CGGGATGTAAGCCTGTAGCAAGG + Intronic
905777704 1:40679997-40680019 CAGAAAGCAAAACTGGAGCCAGG + Intergenic
906064862 1:42973445-42973467 CAGGCTGTAAAATTGGAGCATGG + Intergenic
907103538 1:51859503-51859525 CAGGAGGCAAAGCTAGGGCAGGG - Intronic
907455561 1:54573112-54573134 CAGGACCCATACCTGGAGCCAGG - Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
908846678 1:68331657-68331679 CAAGATGCAACACCGGAGCATGG + Intergenic
909132864 1:71760736-71760758 CAGGATTGCAACCTGAAGCAAGG + Intronic
909284236 1:73794533-73794555 AAGGATGGATGCCTGGAGCAAGG - Intergenic
910735237 1:90446655-90446677 TAGGAAGCAAATGTGGAGCAAGG + Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
913200219 1:116489931-116489953 CAGGATTCAAACTTGGATCGAGG + Intergenic
914328314 1:146642571-146642593 CAGGAGGGAAAACTGGAGCTTGG - Intergenic
915249624 1:154578853-154578875 CTGGATGGAAACCTGGAGCAAGG + Exonic
915445247 1:155970842-155970864 CATCAGGCAAACCTGGAGCTTGG - Intronic
915598782 1:156909740-156909762 CACGCTGCCAACCTGGAGGAGGG - Exonic
916061297 1:161100190-161100212 CAGGATGCAAACCTGTGGACTGG - Exonic
917101518 1:171450739-171450761 GAGGATGAAAAGGTGGAGCAAGG + Intergenic
918363691 1:183784492-183784514 CAGGAGTCAGACCTGGAACATGG + Intronic
919713212 1:200749097-200749119 TAGGATGCAAACAGGGAGGAAGG + Intronic
921844250 1:219862059-219862081 CAGGATTCAAAGCTCCAGCAAGG + Intronic
922308476 1:224365728-224365750 CAGTATGCAAATCTGGGACATGG + Intronic
922847704 1:228702424-228702446 CAGGAGGCAAAGCTGGGCCAGGG + Intergenic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
1063132664 10:3192125-3192147 CAGGGAGTAAACCAGGAGCAGGG + Intergenic
1063459296 10:6204987-6205009 CAGGATCCAAGCCTGGAGGGAGG - Intronic
1066531035 10:36339534-36339556 CAGGATGAAAACTTGGGGAAAGG - Intergenic
1067067540 10:43112316-43112338 CCAGAAGCAGACCTGGAGCAGGG - Intronic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1071010958 10:80939917-80939939 CAGGCTGAAAAACTGGAACAGGG - Intergenic
1072677843 10:97481840-97481862 CAGGATAAAAACCTGTAGAAAGG + Intronic
1072972408 10:100028690-100028712 TAGGAGGCAAAGCTGGGGCAGGG - Intergenic
1073070473 10:100790342-100790364 GAGGGTGCAAACATGGAGCTGGG - Intronic
1074299772 10:112223165-112223187 CAGGACTCAGACCTGTAGCATGG + Intergenic
1074311530 10:112327110-112327132 CAGGAAGCAAAGATGGAGCCAGG + Intergenic
1075579002 10:123602740-123602762 CAGGATGCTAAGGTGGGGCAAGG + Intergenic
1075647073 10:124103653-124103675 AAACATGCAAATCTGGAGCAAGG - Intergenic
1075837016 10:125462519-125462541 CAGGATGCAAACCCTGTGGAAGG - Intergenic
1077524843 11:3057765-3057787 CAGGAGGCCGACCTGGAGCAGGG + Intergenic
1077996073 11:7453751-7453773 CAGCATGCATCTCTGGAGCAAGG + Intronic
1078594098 11:12672104-12672126 CAAGAAGCATATCTGGAGCAAGG + Intergenic
1079152197 11:17910069-17910091 CAGGGTCCAAACTTGGATCAAGG + Intronic
1079246230 11:18754254-18754276 CAGGATGCAAACAGGGTGAAGGG - Intronic
1079420573 11:20283421-20283443 CAGGAGGCAAAGTTGGACCAGGG + Intergenic
1079850992 11:25534150-25534172 CATGATCCAATCATGGAGCAAGG + Intergenic
1080199661 11:29653945-29653967 CAGGATTAAAACCTAGAGGAAGG + Intergenic
1080400926 11:31934788-31934810 CAGGATGCATGCCTGAAGCTGGG - Intronic
1080558322 11:33437912-33437934 CAGAATGCAAACCAGGAACCAGG - Intergenic
1080742299 11:35077807-35077829 CAGGAAGGAAACCTGGTGGACGG + Intergenic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1081708120 11:45198206-45198228 CAGGTTAGAAACCTAGAGCATGG + Intronic
1081867181 11:46366417-46366439 CAGGAGGCAGCCCTGGAGCTGGG - Exonic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1082249082 11:49960185-49960207 CAGCATGCCATCCAGGAGCATGG + Intergenic
1084192008 11:67503706-67503728 CAGGTGTCAAACCTGGAGCAGGG - Intronic
1084272832 11:68038354-68038376 CATGGTGCTGACCTGGAGCAAGG + Intergenic
1086314854 11:85580630-85580652 CAGAAAGCAAAACTGGGGCATGG + Intronic
1087516481 11:99168955-99168977 CATGATGCTCACCTGGAACATGG + Intronic
1091780461 12:3211039-3211061 CAGGCTGTAAAGCTGAAGCAGGG - Intronic
1092452169 12:8612947-8612969 CTGGATCCAAATCAGGAGCAAGG - Intergenic
1097050614 12:56221222-56221244 CAGGCTGCAAACCAAGCGCAGGG + Intronic
1098609823 12:72442680-72442702 CAGGGTGCAAAATAGGAGCAGGG - Intronic
1098915487 12:76252474-76252496 CAGGATGGAAACGTGGAGTGCGG - Intergenic
1099364704 12:81753961-81753983 CAGGAAGCATACCTGTGGCAGGG + Exonic
1101602363 12:106221794-106221816 CAGGAGGAAAACATAGAGCAAGG + Intergenic
1104441207 12:128794769-128794791 AAGGCTGCAAATCAGGAGCAAGG + Intronic
1104877237 12:132044092-132044114 CAACAGGGAAACCTGGAGCAGGG + Intronic
1105892927 13:24695024-24695046 CCGGATGCGAACATGGAACAAGG - Intronic
1107255745 13:38424955-38424977 CAGGAGGCAAAGCTGGGGCAGGG + Intergenic
1108392352 13:49958719-49958741 CAGCAAGCAAACCTGAAGGATGG - Intergenic
1109225660 13:59691679-59691701 CAGGAAGCAAAGCTAGAGAAAGG + Intronic
1113562005 13:111288862-111288884 CAAAATACAAACCTTGAGCAAGG + Intronic
1114453276 14:22839857-22839879 AAGAAAGCAAAGCTGGAGCAGGG + Intronic
1114688921 14:24562268-24562290 CAGAAGGCAAACAGGGAGCAAGG - Intergenic
1116805336 14:49489004-49489026 CAGGACTGACACCTGGAGCATGG + Intergenic
1116930582 14:50687367-50687389 CAGGAACCAATCCTGGAGAAGGG - Intergenic
1116950070 14:50871485-50871507 CAAGATGTAAACCTGTACCAAGG + Intronic
1118187378 14:63549774-63549796 CAGGAAGAAAACAAGGAGCAGGG + Intergenic
1120781827 14:88492511-88492533 TCGGATGCAAACATGGTGCAGGG + Intronic
1124374671 15:29122578-29122600 CAGGATGGGAGCCTGGAGAAAGG + Exonic
1125640962 15:41230670-41230692 CAGGCTGAAAACCTGGAGAAAGG + Exonic
1128387062 15:67157408-67157430 CAGGATTCAAACCCAGACCAGGG - Intronic
1131062104 15:89410595-89410617 CAGGAAGCTGACCTGGAGCTGGG + Intergenic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1132713705 16:1280236-1280258 CAGCACGCCAACCTGGAGCCAGG + Intergenic
1134247687 16:12552231-12552253 TAGGAGGCAAAGCTGGGGCATGG - Intronic
1135356594 16:21774085-21774107 GAGGATTCACACCTGGGGCAAGG - Intergenic
1135455094 16:22590228-22590250 GAGGATTCACACCTGGGGCAAGG - Intergenic
1136580065 16:31146011-31146033 CAGGAGGCAAACCTGAACCCTGG - Intronic
1136914036 16:34164223-34164245 AATGATGCATTCCTGGAGCAAGG + Intergenic
1139116816 16:63964152-63964174 CAGGCTGCAAAATTTGAGCATGG + Intergenic
1139290811 16:65856219-65856241 CAGGATTCAAACCTAGATCATGG - Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1140005250 16:71068370-71068392 CAGGAGGGAAAACTGGAGCTTGG + Intronic
1140031549 16:71343314-71343336 CACGATGCAAAGCTGGGGCTTGG + Intergenic
1141278827 16:82612408-82612430 CAGGATGTAATCCTGGGGCCGGG + Intergenic
1141614158 16:85200965-85200987 CAGGCTCCAAGCCTGGAGCAGGG + Intergenic
1142349362 16:89572860-89572882 CACGAGGCCAACCGGGAGCAGGG - Intergenic
1144254040 17:13447984-13448006 CAGGATGCACCCCTGGGTCAGGG - Intergenic
1145917474 17:28583946-28583968 CAGGTTGCTCACCTGGAGCTGGG - Exonic
1146088244 17:29850546-29850568 AAGGAAGTAAACCAGGAGCAAGG - Intronic
1146277307 17:31523882-31523904 CAGGAAGCTTACCTGCAGCAGGG - Exonic
1147460300 17:40564036-40564058 CAGTATGAAAGGCTGGAGCAGGG + Intronic
1147550356 17:41437506-41437528 CAGGAGGGAGACGTGGAGCACGG + Exonic
1148285471 17:46386803-46386825 CAGGATTCAAACCTGCATGAAGG - Intergenic
1148307634 17:46604403-46604425 CAGGATTCAAACCTGCATGAAGG - Intronic
1149338456 17:55662258-55662280 GAGGATGCAAAAATGGAACAGGG - Intergenic
1150617452 17:66783352-66783374 GAGGATGCAAACTTGGACCCAGG + Intronic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1152756029 17:82087431-82087453 CAGGATGGACATCTGCAGCATGG + Exonic
1154396099 18:13990772-13990794 CAGGAGGCAAAGGGGGAGCAAGG - Intergenic
1155482660 18:26306087-26306109 AAGGAGGCAAACATGGAGCACGG - Intronic
1156234569 18:35189504-35189526 CATGATGAAATCCTGGAACATGG - Intergenic
1156591367 18:38492745-38492767 GAGGATGGAAACCTTGTGCACGG + Intergenic
1157481084 18:48054250-48054272 CAAGAAGCAGTCCTGGAGCAGGG + Intronic
1157662618 18:49459540-49459562 AAGGATGAAAACCTGGAGGGTGG - Intronic
1159019699 18:63133151-63133173 CTGGTTCCAAACCTGCAGCAAGG - Intronic
1160270527 18:77379450-77379472 CAGGACGCACACCTGGAACCTGG - Intergenic
1161935171 19:7367262-7367284 CAGGATGCAAACCTTGACTGAGG + Intronic
1163444570 19:17338990-17339012 GAGGATGACAACCTGGAGGAGGG + Exonic
925914710 2:8596426-8596448 CAGAATGGAACCCTGGAGCCTGG + Intergenic
926035752 2:9634221-9634243 CAGGATGCTATCCTGCTGCAAGG + Intergenic
927086222 2:19676206-19676228 CAGTGTGCTAACCTGAAGCAAGG - Intergenic
927312633 2:21648259-21648281 CAGGATGCTGACCTAGAGGAGGG - Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929668835 2:43853576-43853598 CAGGATGGCAAACTGTAGCAAGG + Intronic
929996093 2:46827060-46827082 CAGGAAGCTTCCCTGGAGCAGGG - Intronic
931428545 2:62192340-62192362 CAGGAGGAAAACCAGGAGCTTGG - Intergenic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
932991369 2:76792053-76792075 AAGCATGCAAACCTGGAGGCAGG + Intronic
933210587 2:79563971-79563993 CAGGATGCATTACTGGAGCCTGG + Intronic
933454102 2:82499418-82499440 AAGGATGCAAACCTTGTGAAAGG - Intergenic
934965516 2:98718616-98718638 CAGGATGAAATCCTGCAGCTTGG - Intronic
935454685 2:103253386-103253408 CAAGATTCAAGCCTGGAGCCTGG + Intergenic
937596009 2:123674298-123674320 CAGTCTGCAAACATGGAGAAAGG + Intergenic
938123084 2:128647223-128647245 CAGGATGCAAGTTTGGAACATGG - Intergenic
939590844 2:144061958-144061980 CAGGATGGAAAGCTGGAGAGGGG - Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
943372986 2:187039571-187039593 CAAGAGGCAAAACTGGGGCAGGG + Intergenic
944414793 2:199470349-199470371 CGGGATGCCAACTTGGGGCACGG + Intronic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
945276252 2:207990306-207990328 CAGGAGGCTAACCTAGAACAGGG - Intronic
945696965 2:213119036-213119058 CAGGATGGAAAGCTGGGGAAAGG + Intronic
947329024 2:229008886-229008908 CAAGATGGAGACCTGGAGCAGGG - Intronic
947973355 2:234343174-234343196 CAGTGTGCAAACCAGGAACATGG - Intergenic
948255956 2:236568090-236568112 CAGGATGCTAACGTAGAGGAAGG - Intronic
948565349 2:238882900-238882922 CAGGGGGCACACCTGGACCACGG - Intronic
1170979220 20:21195554-21195576 CAGGATGCAAACCTGGAGCAAGG - Intronic
1171104642 20:22420979-22421001 CAGGATGGAAATCTTGAGCAAGG - Intergenic
1171245870 20:23608933-23608955 CAGGTGGAAAACCTGGAGGAGGG - Intergenic
1171810036 20:29740378-29740400 AATGATGCATTCCTGGAGCAAGG - Intergenic
1171908943 20:30922796-30922818 AATGATGCATTCCTGGAGCAAGG + Intergenic
1173027704 20:39324883-39324905 AAGGAAGCAAACCTGGAAGATGG + Intergenic
1174012921 20:47465176-47465198 CAGGACCCAACTCTGGAGCATGG - Intergenic
1174107047 20:48169953-48169975 CAGGATGCACGCCTTGTGCACGG + Intergenic
1174417189 20:50375196-50375218 CAAGATGTGAACCTTGAGCAAGG - Intergenic
1175780641 20:61680079-61680101 CAGGGTGCAGCCCTGGGGCAGGG - Intronic
1176661738 21:9642619-9642641 AATGATGCATTCCTGGAGCAAGG - Intergenic
1179131692 21:38643317-38643339 CAGGACTAAAACCTGAAGCAGGG + Intronic
1181286614 22:21757051-21757073 AAGGTTTCAAACCTGGAACAAGG - Exonic
1182794347 22:32979874-32979896 TAGGATTCAAACCTGGAGTATGG + Intronic
1183086898 22:35492035-35492057 CAGGGAGCACACCTGGGGCAGGG - Intergenic
1183086916 22:35492123-35492145 CAGGGAGCACACCTGGGGCAGGG - Intergenic
1183192942 22:36333340-36333362 TAGGATTCACTCCTGGAGCACGG + Intronic
1184210094 22:43030373-43030395 CTGGAAGGGAACCTGGAGCAGGG - Intergenic
1184860938 22:47173066-47173088 GAGGCTGCAAAGCTGCAGCAGGG + Intronic
1184891259 22:47380889-47380911 CAGGATGCTGACCTGGAGCAAGG - Intergenic
1185072980 22:48667357-48667379 CAGGAGGCAGACCAGGAGGAAGG + Intronic
950465076 3:13148848-13148870 GAGAATGCAGCCCTGGAGCAGGG + Intergenic
954445227 3:50542751-50542773 CAGGATGCTGACCTGGAGCAAGG - Intergenic
955549180 3:60065284-60065306 CAGGATTCATCCCAGGAGCATGG - Intronic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
958492289 3:94792637-94792659 CAGGATGACATCATGGAGCAGGG - Intergenic
960932120 3:122863291-122863313 CAGTCTGAAAATCTGGAGCATGG + Intronic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
967464093 3:189781992-189782014 CAGGTTGAAAACCTGAGGCATGG + Intronic
968315629 3:197722167-197722189 CAGGAGGCAAAGGTGGAGCTGGG + Intronic
968916487 4:3499133-3499155 GAGGATGCATCCCTGGGGCAGGG + Intronic
969216962 4:5730689-5730711 CAGGATCCACGCCTGGAGGAAGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970625125 4:17868827-17868849 CAGAATGTAAGCCTGGAGAAAGG - Intronic
972439223 4:39069123-39069145 CAGCATGCCAACCTGTAGGAAGG + Intronic
973000045 4:44936547-44936569 CAGGATGAGAACCTAGTGCAGGG - Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
976821684 4:89214109-89214131 CAGGGTCCAAACCTGAAGCCTGG + Intergenic
977918659 4:102620539-102620561 CAAGTTGGAAGCCTGGAGCATGG - Intergenic
979218111 4:118190667-118190689 CAGGAGGCAAAGCTGGGGCAGGG + Intronic
979402551 4:120266175-120266197 AAGGGAGCAATCCTGGAGCAAGG - Intergenic
980663644 4:135899730-135899752 CAGCATGCACACCTGTAGCCTGG + Intergenic
983406549 4:167338381-167338403 CAGAAGGCAAGCCAGGAGCAAGG - Intergenic
984459533 4:180016048-180016070 CATGAAGCAAACCTGGCACAAGG + Intergenic
985413661 4:189713929-189713951 AATGATGCATTCCTGGAGCAAGG + Intergenic
990877541 5:60502607-60502629 CAGATTGAAAACCTGTAGCAGGG - Intronic
992228185 5:74639509-74639531 CAGGTTCAAAACCTGGAGAAGGG - Intronic
992530951 5:77651137-77651159 GAAGGTGCAAACCTGGAGCTAGG + Intergenic
997399718 5:133592977-133592999 CAGGAAGGATACCTGGACCAAGG + Intronic
997401510 5:133606971-133606993 CAAGATCCAAGCCTGGAGCTTGG + Intronic
997929162 5:138058225-138058247 CAGGATGCCATCCTGTTGCAGGG + Intergenic
998298219 5:140992492-140992514 AAGGATTCAATCCTGGGGCATGG + Intronic
1000364403 5:160477667-160477689 CAGGATGCAAAACAAGAGTAGGG + Intergenic
1001753226 5:174147291-174147313 CAGGATCCTAACCTGCAGGATGG - Intronic
1001914381 5:175547441-175547463 CAGGATTTAAACCTAGAGAAAGG - Intergenic
1002841707 6:912070-912092 CAGGATGCAAAGCAGGAGCCCGG - Intergenic
1004084721 6:12434686-12434708 CAGGCTGTAAACCAGGAGAAAGG - Intergenic
1004219751 6:13736118-13736140 CAGGATGTGAACCTGGTTCATGG - Intergenic
1008003463 6:46385335-46385357 AAAGATGCAAATTTGGAGCAGGG - Intronic
1013676054 6:112464274-112464296 CAGGAGGCAAAGCTAGGGCAGGG + Intergenic
1016290797 6:142526485-142526507 CAGGATCCAAACCTGCAGGAAGG + Intergenic
1018718513 6:166554500-166554522 CAGGATGCACATCCGGAGCTGGG - Intronic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1022378119 7:29834179-29834201 CATGATGCCAGCCTCGAGCAAGG - Intronic
1025253452 7:57367341-57367363 CAAGATGTGAACCTTGAGCAAGG + Intergenic
1025995055 7:66522702-66522724 CAGGATGCAGACCTGGGCCTTGG - Intergenic
1030157198 7:106467353-106467375 CAGGCTGCAATCCTTGAGCCTGG + Intergenic
1030864890 7:114688856-114688878 CAAGAGGAAAACCTGCAGCAAGG - Intronic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034746137 7:153525415-153525437 CAGGATGCAAACAGTGGGCATGG - Intergenic
1035071565 7:156148709-156148731 CACAATGCAAACCAGCAGCACGG - Intergenic
1035229976 7:157459251-157459273 CAGGATGCAAAACTGTACCTAGG - Intergenic
1035494499 7:159311377-159311399 CAGGAGGCAAAGCTAGGGCAGGG - Intergenic
1036788357 8:11702490-11702512 CCGGTTTCAAACCGGGAGCAGGG + Intronic
1037197939 8:16214990-16215012 AAGGATGCAAACCTGCTGAAAGG + Intronic
1037691697 8:21186328-21186350 CAGGGGGCATACCTGGAGGAGGG - Intergenic
1040802859 8:51363090-51363112 CAGGAGGCAAAACTGGGCCAGGG - Intronic
1041584065 8:59495554-59495576 GAGGATAAAAATCTGGAGCAGGG - Intergenic
1045341289 8:101256945-101256967 CAGGATGGGCACCTGGAGCCGGG + Intergenic
1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG + Intronic
1045664076 8:104467042-104467064 CAGGCTGCAAATCCGGAGCCCGG + Exonic
1046960427 8:120106858-120106880 CAGGCTACAAACCTGGATGAAGG + Intronic
1048064045 8:130949719-130949741 AAGGAGGAAAACCTGGGGCAAGG - Intronic
1048966714 8:139620203-139620225 CAGAATAAAAACCTGGATCATGG + Intronic
1049000377 8:139822247-139822269 CAGGAAGCAGACCTGGAAGACGG + Intronic
1049634756 8:143681638-143681660 CAGGAGGCAAAACTGGCGAAAGG + Intergenic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1057453829 9:95189827-95189849 CAGGAAGAAAAGCTGCAGCATGG - Intronic
1058216551 9:102240959-102240981 CAGGAGGCAAAGCTGGGTCAGGG - Intergenic
1058766225 9:108185159-108185181 CAAGATGCATACCTGCAGCCTGG + Intergenic
1058830652 9:108813344-108813366 CAGAAAGCAAACCAGGAGCATGG + Intergenic
1059612262 9:115911308-115911330 CATGCAGCCAACCTGGAGCATGG + Intergenic
1059723634 9:116985493-116985515 CTGGCTGAGAACCTGGAGCAGGG - Intronic
1059791654 9:117647141-117647163 CAGGAAGCAGACCAAGAGCAGGG + Intergenic
1060404342 9:123365866-123365888 CAGGATGGACACCCAGAGCAGGG - Intronic
1060623397 9:125088487-125088509 CAGGAAACAATCCTGGAGAAAGG - Intronic
1060803436 9:126558942-126558964 CAGGCTGCTATCCTGGAGGAGGG - Intergenic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1060889233 9:127177654-127177676 GAGGTTGCAGACCTGGAGCCAGG + Intronic
1061630827 9:131871130-131871152 CAGGACGCACACCTGGATCCAGG - Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1062393301 9:136342577-136342599 CAGGCTGCACACCTAGAGCCTGG + Intronic
1062453989 9:136627185-136627207 CAGGAAGCCCAGCTGGAGCACGG + Intergenic
1203360327 Un_KI270442v1:216118-216140 AATGATGCATTCCTGGAGCAAGG - Intergenic
1203639299 Un_KI270750v1:144462-144484 AATGATGCATTCCTGGAGCAAGG - Intergenic
1185693610 X:2177417-2177439 CAGAATGGAAAACTGGTGCATGG + Intergenic
1188418644 X:29969928-29969950 CACAATACAGACCTGGAGCAAGG - Intergenic
1189935121 X:46059493-46059515 CAGGATGGAGCCCTGGACCAGGG + Intergenic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1192366816 X:70480606-70480628 CAGGCTGCAGACTGGGAGCAAGG - Intronic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1195037960 X:100987348-100987370 AAGGCTGCAGACCTGGAGCCTGG - Intronic
1195275729 X:103278263-103278285 CAGGCAGCAATCCTGCAGCAAGG - Intergenic
1195965497 X:110426678-110426700 CAGGCTTCATACCTGGAGCTCGG + Intronic
1197226812 X:123962096-123962118 CAGGCTGCCTACCTGGGGCAAGG - Intronic
1198610674 X:138396244-138396266 CAGAAGGCAAAGCAGGAGCAGGG - Intergenic
1200229865 X:154438512-154438534 CAGGATGCATTCCTGGGGGAGGG - Exonic
1200985546 Y:9299923-9299945 CAGGCTGCCAACCTGGGACAAGG + Intergenic
1201078103 Y:10201424-10201446 AATGATGCATTCCTGGAGCAAGG + Intergenic