ID: 1170982371

View in Genome Browser
Species Human (GRCh38)
Location 20:21226755-21226777
Sequence GAGATCAGGCTGAGGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170982371_1170982378 4 Left 1170982371 20:21226755-21226777 CCAGCAGTCCTCAGCCTGATCTC 0: 1
1: 0
2: 1
3: 24
4: 271
Right 1170982378 20:21226782-21226804 GCCCTTTAGGACTCAGGTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 128
1170982371_1170982374 -9 Left 1170982371 20:21226755-21226777 CCAGCAGTCCTCAGCCTGATCTC 0: 1
1: 0
2: 1
3: 24
4: 271
Right 1170982374 20:21226769-21226791 CCTGATCTCGCCAGCCCTTTAGG 0: 1
1: 0
2: 1
3: 9
4: 100
1170982371_1170982377 3 Left 1170982371 20:21226755-21226777 CCAGCAGTCCTCAGCCTGATCTC 0: 1
1: 0
2: 1
3: 24
4: 271
Right 1170982377 20:21226781-21226803 AGCCCTTTAGGACTCAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 123
1170982371_1170982375 -2 Left 1170982371 20:21226755-21226777 CCAGCAGTCCTCAGCCTGATCTC 0: 1
1: 0
2: 1
3: 24
4: 271
Right 1170982375 20:21226776-21226798 TCGCCAGCCCTTTAGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170982371 Original CRISPR GAGATCAGGCTGAGGACTGC TGG (reversed) Intronic
900070675 1:769583-769605 CAGCACAGGCTGAGGAGTGCAGG + Intergenic
900361326 1:2290404-2290426 GTGCTCAGGCTGAGCAGTGCAGG - Intronic
901441714 1:9282154-9282176 GGTCCCAGGCTGAGGACTGCAGG - Intergenic
902184933 1:14717918-14717940 GAGAGCAGGCTGGGAACAGCAGG - Intronic
902237848 1:15068997-15069019 GTGGTCAGGCTGAGAACTGCTGG - Intronic
902634927 1:17728890-17728912 GAGACAAGACTGAGGGCTGCAGG - Intergenic
902642612 1:17776372-17776394 GAGCTGATGGTGAGGACTGCTGG + Intronic
903328833 1:22586613-22586635 GGGTGCAGGCTGAGGACGGCGGG - Exonic
904947897 1:34212783-34212805 GAGATCAGGGTGCGGACAGTGGG - Intronic
906100052 1:43254408-43254430 GAGAGGAGGCTGAGGACTGGGGG + Intronic
906473247 1:46148906-46148928 GAAATTAGGCTGAGACCTGCTGG + Intronic
907285362 1:53376395-53376417 GAGAGCAGGGTGAGGACAGGAGG + Intergenic
908820264 1:68078630-68078652 CAGAACAGGCTGACGACTTCTGG - Intergenic
911697391 1:100906410-100906432 GATACCAGGCTGAGGACAGTGGG - Intronic
913134485 1:115874663-115874685 GAAATAAGGCTGAGACCTGCTGG - Intergenic
915606976 1:156958570-156958592 TTGGTCAGGCTGAGGGCTGCAGG - Intronic
918076328 1:181173987-181174009 GAAATGAGGCTGAGAGCTGCTGG + Intergenic
921053158 1:211525343-211525365 AAAATAAGGCTGAGGCCTGCTGG + Intergenic
921294249 1:213687208-213687230 GAAATGAGGCTGAGACCTGCTGG - Intergenic
923517871 1:234712792-234712814 GAGATGAGGCTGGAGACAGCAGG - Intergenic
924933881 1:248751801-248751823 GTGTCCAGGCTGAGGACTGTGGG - Intronic
1062961299 10:1575624-1575646 GGGAGGAGGCTGAGGACTGAGGG - Intronic
1063010043 10:2012530-2012552 GACCCCAGGCTGAGGACTGAGGG - Intergenic
1064532745 10:16326682-16326704 GAGATCAGCCTGAGCAATGTAGG + Intergenic
1066196228 10:33102835-33102857 CAGATTTGCCTGAGGACTGCAGG - Intergenic
1066435932 10:35396782-35396804 GAGAGCACGAAGAGGACTGCAGG - Intronic
1067064329 10:43095185-43095207 GAGCTGAGGCTGGGGGCTGCAGG + Intronic
1067250397 10:44581670-44581692 GAGGTGAGGCTCAGCACTGCAGG + Intergenic
1067947415 10:50698722-50698744 GAGCTCAGGCTGAAAACAGCAGG + Intergenic
1069673963 10:70233750-70233772 GAGATAAGGAATAGGACTGCGGG - Intronic
1069953573 10:72036042-72036064 GAGATCAGGCTGGGGAAAGGAGG - Intergenic
1069993557 10:72329256-72329278 GGGATCAGGCTAGGGCCTGCAGG - Intergenic
1070171758 10:73938205-73938227 GAGAGTAGGCAGTGGACTGCGGG + Intergenic
1070331858 10:75423196-75423218 GAGATGAAGCTGAGATCTGCAGG - Intergenic
1070882729 10:79863709-79863731 GAGCTCAGGCTGAAAACAGCAGG + Intergenic
1071095699 10:81971744-81971766 GAGATAAAGCTGAAAACTGCAGG + Intronic
1071567780 10:86680584-86680606 GAGATCTGGGTGAGGCCAGCAGG - Intronic
1071649295 10:87380011-87380033 GAGCTCAGGCTGAAAACAGCAGG + Intergenic
1073454026 10:103625925-103625947 GAGGTGAGGCTGGGGACTGCAGG + Intronic
1075016753 10:118915334-118915356 GAGGTCAGGCAGAGAGCTGCCGG - Intergenic
1075073690 10:119336228-119336250 GAAGGAAGGCTGAGGACTGCAGG - Intronic
1075375350 10:121974527-121974549 GAGCCCACGCCGAGGACTGCCGG + Intronic
1075664775 10:124222501-124222523 GTGAGCAGCCTGAGGGCTGCTGG - Intergenic
1076327538 10:129638007-129638029 GAGACCAGACTGAGCACTGCAGG - Intronic
1077048321 11:555720-555742 GAGACCAGGGTGGGGACCGCGGG - Exonic
1077435328 11:2536163-2536185 GAGCTCAGGCTCAGGGCAGCAGG + Intronic
1077501892 11:2913051-2913073 GAGCGGAGGCTGAGGAGTGCAGG + Intronic
1077544537 11:3163686-3163708 GAGACCAGGCCCAGGACTGCAGG + Intronic
1078283203 11:9923665-9923687 GAGATCATGCTGTGAATTGCAGG + Intronic
1078405853 11:11069389-11069411 GAGAGGAGAGTGAGGACTGCTGG - Intergenic
1078600734 11:12728115-12728137 GAGGTGAGCCTGAGGACTGTGGG + Intronic
1079098621 11:17527025-17527047 GGGATCAGGCCGATGTCTGCGGG + Exonic
1079410098 11:20179570-20179592 CAGATGAGGCTGGGCACTGCAGG - Intergenic
1080382738 11:31790838-31790860 GAGGTCTGGCTGGGGACTGGGGG + Exonic
1081373286 11:42330216-42330238 GAGAGCATGCCCAGGACTGCCGG + Intergenic
1081785800 11:45746233-45746255 GAGAGAAGGCTCAGGACAGCAGG + Intergenic
1082722935 11:56701012-56701034 GAGGCCAGGATGAGCACTGCGGG - Exonic
1083421064 11:62553549-62553571 GAGATCAGGCTGAGCAGGGAAGG + Intronic
1084740294 11:71135051-71135073 CAGAGAAGGCTGAGGGCTGCGGG - Intronic
1085243117 11:75075015-75075037 GAGAAAAGGCTGATGACAGCAGG - Intergenic
1085246799 11:75108530-75108552 GAGAAAAGGCTGATGACAGCAGG - Intronic
1085512570 11:77095766-77095788 AAGAACAGGCCCAGGACTGCAGG + Intronic
1085953300 11:81359377-81359399 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1089216864 11:116839440-116839462 GAGATCAGACTCGTGACTGCTGG + Intergenic
1090513508 11:127399972-127399994 GAGATTAGACTGAGGTCTCCAGG - Intergenic
1093140847 12:15508850-15508872 GAAGCCAGGCTGAGGTCTGCTGG + Intronic
1094161079 12:27391812-27391834 CAGATCCCCCTGAGGACTGCTGG - Intronic
1096361851 12:50994589-50994611 GAGGCCAGCATGAGGACTGCTGG + Exonic
1096695697 12:53346767-53346789 GAGATCAGGAGGAGCAGTGCTGG - Intergenic
1097575931 12:61392404-61392426 TAGATGAGGCTGAGGAATTCAGG + Intergenic
1098470824 12:70841413-70841435 GAGAACAAGCTGAGAAGTGCAGG - Intronic
1099008959 12:77268470-77268492 AAAATAAGGCTGAGAACTGCTGG - Intergenic
1099018736 12:77377308-77377330 GAGATGAGCCTAAGGCCTGCTGG + Intergenic
1099415314 12:82377916-82377938 GACATCAGGATAAGAACTGCTGG + Intronic
1102217859 12:111174282-111174304 CAGACCAGGCTGATGACAGCAGG + Intronic
1102587127 12:113931350-113931372 GAGGCCATGCTGAGGGCTGCTGG - Intronic
1104800679 12:131553606-131553628 GAAATAAGGCTGAGTCCTGCTGG - Intergenic
1104808580 12:131605565-131605587 AAGATCAGGCTGAGACCTACTGG - Intergenic
1105015168 12:132782148-132782170 GAGAACAGGCTCAGGAGTCCGGG - Intronic
1105715101 13:23055590-23055612 GAGTTGAGGCGGAGGCCTGCTGG - Intergenic
1106113335 13:26795881-26795903 TAGCTCAGGCTGAGGTCTGGTGG + Intergenic
1106927620 13:34630109-34630131 CAGAGCAGCCCGAGGACTGCTGG + Intergenic
1109172294 13:59112024-59112046 GCAACCAGGCTGACGACTGCGGG + Intergenic
1109896272 13:68695788-68695810 GAGATCATGTTGAGGAATACTGG + Intergenic
1110046557 13:70840535-70840557 GAAATAAGGCTGAGACCTGCTGG + Intergenic
1110046591 13:70840870-70840892 CAGAGCAGACTGAGGGCTGCTGG - Intergenic
1110046747 13:70841697-70841719 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1110246258 13:73327679-73327701 GCATTCAGGCTGAGAACTGCTGG - Intergenic
1113366869 13:109684562-109684584 GAGATAAGTCGGAGAACTGCAGG - Intergenic
1114445313 14:22783770-22783792 GAAATCAGGCTCAGGAGTGGGGG - Intronic
1114559784 14:23581123-23581145 GAGTGCGGGCTGAGGAGTGCGGG + Intergenic
1114586261 14:23816745-23816767 GAGAGAAGAATGAGGACTGCAGG + Intergenic
1117398940 14:55340444-55340466 GAGATCAGACTGAGCAATACAGG - Intronic
1118934674 14:70276256-70276278 GAGCCCAGCCTGAGGACTGAAGG - Intergenic
1121182764 14:91942040-91942062 CTGAGCAGGCTGAGGGCTGCAGG - Intronic
1121395803 14:93622253-93622275 GTGCTCAGGCTGAGGACGGAGGG - Exonic
1122255024 14:100470277-100470299 CAGATGAGTCTGAGGAGTGCAGG + Intronic
1122661876 14:103301582-103301604 GAGGCCAGGCTGAGAACCGCTGG - Intergenic
1122755247 14:103973543-103973565 GAGAAGAGGCAGAGGGCTGCCGG + Intronic
1123114755 14:105889679-105889701 CAGATCAGGGTGAGGACTGCAGG + Intergenic
1123116924 14:105899080-105899102 GAGACCAGGGTAGGGACTGCAGG + Intergenic
1123403908 15:20009514-20009536 GAGACCAGGGTGGTGACTGCAGG + Intergenic
1123513248 15:21016160-21016182 GAGACCAGGGTGGTGACTGCAGG + Intergenic
1124438932 15:29673352-29673374 GAAATAAGGCTGAGACCTGCTGG - Intergenic
1124988734 15:34649720-34649742 GAAATCAGACAGAGGAGTGCTGG - Intergenic
1128532742 15:68465633-68465655 GAGAACTGGCTGAAGACTGGTGG - Intergenic
1132739048 16:1401861-1401883 GGGATTTGGATGAGGACTGCGGG - Intronic
1132791713 16:1693587-1693609 TAGATCAGGTAGAGGACTGTAGG + Intronic
1133423034 16:5663668-5663690 GGCACCATGCTGAGGACTGCAGG + Intergenic
1133465942 16:6027112-6027134 GAGATGAGGGTGAGGACTTGAGG + Intronic
1135151198 16:20007698-20007720 GAGCTCAGGCTGGGGACTGATGG - Intergenic
1135576207 16:23587806-23587828 GAGATCAGGGAGATAACTGCTGG - Intronic
1136364741 16:29804842-29804864 AGGAGAAGGCTGAGGACTGCTGG + Exonic
1137770668 16:51013731-51013753 GAGCTCAGGCTGTGGTCTTCTGG - Intergenic
1138045856 16:53724078-53724100 AAGATCAGGATGACAACTGCTGG - Intronic
1138514023 16:57526068-57526090 CAGAGGAGTCTGAGGACTGCTGG - Exonic
1140281310 16:73557468-73557490 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1143102680 17:4513046-4513068 GGGAACAGGCTGAGGACAGGAGG + Intronic
1143253386 17:5538453-5538475 GACGTCAGGCTGAGGTCTGAAGG - Intronic
1144014205 17:11178451-11178473 GAGATTGGGCTGTGGACAGCAGG - Intergenic
1144703731 17:17354183-17354205 GAGCTGGGGCTGAGGGCTGCGGG + Intergenic
1146821475 17:35986342-35986364 GAGATGAGACTTAGGACTGTAGG - Intronic
1146821606 17:35987177-35987199 GAGATGAGACAGAGAACTGCAGG - Intronic
1147260038 17:39204524-39204546 GTGACCAGGCTGAGGCCCGCAGG + Exonic
1148100014 17:45083810-45083832 GAGATCAACCTGAGTAATGCAGG - Intronic
1149044052 17:52223953-52223975 AAAATAAGGCTGAGAACTGCTGG - Intergenic
1149864494 17:60143193-60143215 GAGGTCAGAGTGAGGACTCCAGG + Intergenic
1150130060 17:62664333-62664355 CAGATGAGGCAGAGGCCTGCAGG - Intronic
1151836414 17:76585578-76585600 GAGGTTGGGCTGAGGGCTGCGGG + Intronic
1152147843 17:78579805-78579827 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1152324368 17:79627109-79627131 GTGACCAGGCTGGGGACTGCAGG + Intergenic
1152753318 17:82076604-82076626 AAAATGAGGCTGAGGATTGCAGG - Intergenic
1157220182 18:45824009-45824031 GAGATGATACTGAGGACTGAGGG + Intergenic
1157709034 18:49835719-49835741 GATATGAGGCTGAGGATTTCAGG - Intronic
1158312307 18:56171420-56171442 GCACTCAGGCTGAGAACTGCTGG - Intergenic
1159091463 18:63853951-63853973 GAGATCAGGCTGGAGACTCTTGG - Intergenic
1159626663 18:70703153-70703175 GAGATCAAGATGAAGGCTGCAGG + Intergenic
1159864790 18:73691301-73691323 CAGATGAGGCTGAGAGCTGCTGG + Intergenic
1160628987 18:80232326-80232348 GAGCACAGGCCCAGGACTGCAGG - Intronic
1160651745 19:234512-234534 CAGCACAGGCTGAGGAGTGCAGG + Intergenic
1161514722 19:4690076-4690098 CTGACCAGGCTGGGGACTGCCGG - Intronic
1161573204 19:5041462-5041484 GAGCTCAGGGTGGGGGCTGCAGG - Intronic
1162530210 19:11231557-11231579 AAGCACAGGCTCAGGACTGCTGG + Intronic
1163769258 19:19180724-19180746 AGGATCAGGCTGAGGAGGGCGGG + Exonic
1164560783 19:29290736-29290758 GGGACCAGGCTGGGGCCTGCCGG - Intergenic
1165143246 19:33715283-33715305 GAGATCATGCTGGAGACAGCAGG - Intronic
1166046128 19:40232190-40232212 GAGCTCAGGGTGAGGGCAGCTGG - Exonic
1166662587 19:44657090-44657112 GAGATGAGGGTGAGCTCTGCGGG + Intronic
1166894584 19:46015725-46015747 GGGATCAGGGTGAGGTCCGCTGG + Intronic
1167206252 19:48104682-48104704 GGGCTCAGGCGGAGGACTGCGGG - Exonic
1167296675 19:48654562-48654584 GAGATGAGGCTGGGGACTGGGGG - Intergenic
1168681060 19:58316190-58316212 TAGAGCAGGCTGAGGAAGGCAGG - Intergenic
925474706 2:4200172-4200194 TAGAGCAGGCAGAGGACAGCAGG + Intergenic
928233418 2:29519778-29519800 GAAATCACTCTGAGGCCTGCAGG + Intronic
929238731 2:39631783-39631805 GATATCAGGCTGAGGAGAGGAGG + Intergenic
930017570 2:46981498-46981520 GGGATGAGGCTGAGGATTGTAGG + Intronic
931368521 2:61640528-61640550 AAAATAAGGCTGAGGCCTGCTGG + Intergenic
931680978 2:64750186-64750208 GGGATCAGGTTGTGGGCTGCAGG - Intronic
931686279 2:64796794-64796816 GTGATGAGGCTGAGGAGTGAGGG + Intergenic
935796032 2:106642326-106642348 GAAATCAAGCTGAGGCATGCTGG - Intergenic
937932493 2:127218133-127218155 GAGCTCAGGGTGAGGGCTGGCGG + Intronic
938104708 2:128521870-128521892 GAGATCAGGGTAAGGACTCCAGG + Intergenic
944867845 2:203880006-203880028 GAGTTCAGGCTGAGGGATGCTGG + Intergenic
946440141 2:219688095-219688117 GAAATGAGGCTGAGACCTGCTGG - Intergenic
946710392 2:222499428-222499450 GGCATCAGGCAGAGGACTCCAGG + Intronic
947593932 2:231399417-231399439 GAGACCAGGGTGTGGACTGGGGG - Exonic
948214733 2:236220276-236220298 GAGCCCAGGCTGAGGCCTCCAGG - Intronic
948341103 2:237252846-237252868 GAGATGAGGCTGAGGAAGGCAGG - Intergenic
1170101051 20:12700073-12700095 GAGATCAAGCAGAGGCCTCCCGG + Intergenic
1170449003 20:16462312-16462334 GAGAACCGGGTGAGGATTGCAGG - Intronic
1170946960 20:20900203-20900225 TACATCATGCTGAGGACTGGGGG - Intergenic
1170982371 20:21226755-21226777 GAGATCAGGCTGAGGACTGCTGG - Intronic
1172798446 20:37559518-37559540 GAAATGAGGCTGAGACCTGCTGG + Intergenic
1175636858 20:60591662-60591684 GAGAGCAGGCTGGGGGCTGCAGG + Intergenic
1175674333 20:60933922-60933944 GAGTTCAGGATCAGGACTCCAGG + Intergenic
1177801294 21:25831442-25831464 AAAATAAGGATGAGGACTGCTGG + Intergenic
1178459528 21:32790100-32790122 AAAATAAGGCTGAGGCCTGCTGG - Intergenic
1178931874 21:36826311-36826333 GAGATCAGTATGAGGGCTGGAGG - Intronic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181436377 22:22913669-22913691 GAGACCAGGTTGAGGGGTGCAGG + Intergenic
1181696311 22:24594548-24594570 GAGACAAGGCAGAGGACAGCAGG + Intronic
1182149274 22:28017199-28017221 GAGACCAGGCTGTGGATTCCAGG + Intronic
1182350627 22:29697359-29697381 GGGAGCAGGCTGGGAACTGCAGG + Exonic
1182475042 22:30572696-30572718 GTCATCAGGCTGGGGACTGCTGG - Intronic
1184656030 22:45942430-45942452 GAGCTCAGGCTGGGGACATCGGG + Intronic
950145677 3:10648115-10648137 GAGATCAGCCTGAGGGTTGCCGG + Intronic
950387383 3:12670884-12670906 CAGATGAGGCTGAGGACAGAGGG + Intergenic
950757155 3:15184793-15184815 GAGCTCAGGTTTAGGAGTGCTGG + Intergenic
953520327 3:43636271-43636293 GGGAGCTGGTTGAGGACTGCTGG + Intronic
955094674 3:55785533-55785555 GAGTTGAGGTTGAGGAATGCAGG - Intronic
961688673 3:128652941-128652963 CAGAGCAGCCCGAGGACTGCTGG + Intronic
962216984 3:133531223-133531245 GGATTCAGGCTGAGGACTGTGGG - Intergenic
966597278 3:181736081-181736103 GTGTTCAGTGTGAGGACTGCAGG - Intergenic
968525950 4:1057246-1057268 GAGAGAACGCTGAGGCCTGCAGG + Intronic
969054427 4:4392762-4392784 GGGAGCAGGCAGAGGGCTGCTGG - Intronic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
971671139 4:29559507-29559529 GAAATGAGGCTGAGTCCTGCTGG + Intergenic
972290562 4:37686528-37686550 GGGATCAGGCTGAGGTGGGCGGG - Intergenic
972665949 4:41165758-41165780 GCGATCAAGCTGGTGACTGCTGG - Intronic
972948990 4:44295091-44295113 GAGATCAGGCTGGGTAATGTGGG + Intronic
973087103 4:46078518-46078540 GAGATCAGCCTATGGAATGCCGG + Intronic
974003074 4:56530446-56530468 GAGATGAGGCTGAGTCCGGCCGG + Intergenic
976758233 4:88521442-88521464 CATATCAGGCTTAGGACTGTGGG - Exonic
976876533 4:89860182-89860204 GAGAATAGGCTGAGAACTCCAGG + Intergenic
980563611 4:134508735-134508757 GAGCTCAGGCTAAGGGCTGAGGG - Intergenic
982302786 4:153897364-153897386 GAGATCCGGCTGAACACAGCAGG + Intergenic
984118024 4:175706720-175706742 GAAATAAGGCTGAGACCTGCTGG + Intronic
984170848 4:176357742-176357764 GAAATGAGGCTGAGAACTACTGG - Intergenic
984696801 4:182787325-182787347 GAGATCAGGCTTCGGACTCTTGG + Intronic
984765596 4:183398366-183398388 GAGGACAGGCCGAGAACTGCTGG + Intergenic
985668207 5:1192769-1192791 GAGAAAAGGCTGAGGAGTGGGGG + Intergenic
985957691 5:3277017-3277039 GGGCTCAGGCTGAGGACAGCAGG + Intergenic
986667574 5:10116732-10116754 GAGATCAGGGTGGGGTCAGCTGG + Intergenic
987842311 5:23237326-23237348 TTGGGCAGGCTGAGGACTGCAGG + Intergenic
988266048 5:28952411-28952433 GAGATCAGTCTAACGACTGATGG + Intergenic
988781141 5:34522798-34522820 GAAATAAGGCTGAGACCTGCTGG - Intergenic
992025555 5:72665648-72665670 TAAATCAGGCTGACCACTGCAGG - Intergenic
995446924 5:112254873-112254895 GAGAACAGACTGAGGAGTGAGGG - Intronic
996197790 5:120631537-120631559 GGGATGAGGCTGGTGACTGCTGG + Intronic
997059323 5:130481838-130481860 GAGCTCAGGAGGAGGACTGAAGG - Intergenic
997860267 5:137409390-137409412 GGGATAAGGCTGAAGAGTGCTGG + Intronic
999135454 5:149315929-149315951 GGGCTCAGGCTGGGGAATGCTGG + Intronic
999269163 5:150286440-150286462 GAGGTCTGGCTCAGGACTGCAGG - Intronic
1001386681 5:171345143-171345165 CTGACCAGGCTGAGGCCTGCAGG - Intergenic
1005448592 6:25951741-25951763 AAAATAAGGCTGAGGCCTGCTGG - Intergenic
1005449039 6:25955265-25955287 GAAATAAGGCTGAGTCCTGCTGG + Intergenic
1006365132 6:33610831-33610853 GAGACCTGACTGAGGTCTGCAGG - Intergenic
1006810496 6:36817507-36817529 GATGTCAGGCTGAGGACAGCTGG - Intronic
1006838708 6:37014743-37014765 GGGACCAGGCTGAGACCTGCAGG - Intronic
1013244728 6:108275619-108275641 GAGAAGAGGCTAAGTACTGCTGG + Intergenic
1013409776 6:109873468-109873490 GAGAGGAGGCTGAGCACTGTGGG + Intergenic
1019652608 7:2168585-2168607 CAGATCAGGATGAGGTCTCCTGG - Intronic
1023248195 7:38229673-38229695 GAGATGCGGCTGAGGTGTGCTGG - Intronic
1023664382 7:42506573-42506595 GAGATCAGGTTGTGGAATACTGG + Intergenic
1024242739 7:47448033-47448055 GAGGGGAGGCTGTGGACTGCTGG + Intronic
1025017446 7:55450259-55450281 GAGAAGAGGCGGAGGACTGGTGG - Intronic
1025849412 7:65233729-65233751 GAGATAAGGCTGAGACCTACTGG + Intergenic
1026097750 7:67360103-67360125 GAAATAAGGCTGAGACCTGCTGG + Intergenic
1026237147 7:68537009-68537031 AATATCAGGCTGATGCCTGCCGG + Intergenic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1026917955 7:74133814-74133836 AAGATGAGGCTGAGACCTGCTGG + Intergenic
1029108437 7:98196956-98196978 GCGTTCAGGCCGAGGACTGAGGG + Intronic
1029119202 7:98255164-98255186 AAAATGAGGCTGAGAACTGCTGG + Intronic
1033266051 7:139888177-139888199 GAGCTCTGGGTGAGGACTACTGG - Intronic
1034233460 7:149550649-149550671 GACTTCAGGCTGAGGAGGGCTGG - Intergenic
1034274551 7:149818330-149818352 GAGCTCAAGCTGAGGAAGGCTGG + Intergenic
1034383926 7:150722339-150722361 CAGCTCAGGCTAAGGACTGCAGG + Exonic
1035041520 7:155931619-155931641 GAGAGCTGGCAGGGGACTGCTGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036408757 8:8479087-8479109 GAGACCAGGCTGAGTGCTCCTGG + Intergenic
1036642428 8:10592756-10592778 ATGGGCAGGCTGAGGACTGCGGG - Intergenic
1036747179 8:11418149-11418171 GAAATGAGGCTGAGACCTGCTGG - Intronic
1038203365 8:25438412-25438434 AGAATCAGCCTGAGGACTGCTGG - Intronic
1041181702 8:55256099-55256121 GAGCTGAGGCTGAGGAAGGCAGG + Intronic
1041982460 8:63878498-63878520 GATATCAGGCTCAGGACAGCGGG - Intergenic
1041988353 8:63954342-63954364 GAGATCAGGATGAGCACTTCTGG + Intergenic
1042827429 8:72993090-72993112 GATATCAGGCTTTGGCCTGCAGG - Intergenic
1044975081 8:97656671-97656693 GGCATCAGGCTAAGGACTGTAGG - Intronic
1047766154 8:127991726-127991748 GAGGCCATGCTCAGGACTGCGGG - Intergenic
1048748470 8:137643304-137643326 AAGAACAGGCTGAGAACTCCAGG - Intergenic
1049444352 8:142623241-142623263 GGCAGCAGGCTGAGGACTGGCGG - Intergenic
1049461819 8:142733516-142733538 GAAATGAGGCTGGGGCCTGCTGG - Intronic
1049853758 8:144849016-144849038 GAGGTCAGCCTGAGGACCGAGGG + Intronic
1049963462 9:757699-757721 TAGGTCAGGCTGAGGAGTGAAGG - Intergenic
1050624187 9:7486260-7486282 AAGCTGAGGCTGAGGCCTGCTGG - Intergenic
1052521574 9:29554431-29554453 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1052652421 9:31321502-31321524 GAGAGGGGGCTGAGGACAGCTGG - Intergenic
1054958242 9:70938298-70938320 GAGAGCAGGCTCAGGACTCAGGG - Intronic
1055544494 9:77354966-77354988 GAGATGAAGAAGAGGACTGCTGG - Intronic
1055806448 9:80099860-80099882 GAGATCAGGATGAGGAATTCTGG - Intergenic
1055845693 9:80559855-80559877 GATAACAGACTGAGGACTGGTGG - Intergenic
1055949829 9:81720226-81720248 GAGCTCAGGCTGAAAACAGCAGG - Intergenic
1056331072 9:85521842-85521864 GAGAACAGGCTGCGGGCGGCTGG + Intergenic
1056575615 9:87854012-87854034 GAGCTCAGGCTGAAAACAGCAGG - Intergenic
1056601088 9:88047569-88047591 GAAATAAGGCTGAGAAATGCTGG - Intergenic
1059741500 9:117155062-117155084 GAGATCAAACTGTGGAGTGCTGG + Intronic
1059751720 9:117253816-117253838 GAGGTCAGCCTCAGGACTACTGG + Intronic
1059889632 9:118786957-118786979 GATACCAGGCTGAGGGCTGGTGG + Intergenic
1059936779 9:119319846-119319868 GAGATGAGGCTGGGGAATGCTGG - Intronic
1060258479 9:122053354-122053376 GAAATCAGGCAGAGGACTATAGG + Intronic
1060517704 9:124276161-124276183 GAGCTCAGGCTGTGGACACCAGG - Intronic
1060847165 9:126846768-126846790 GATTTCAGGCTGAGGACTGGTGG + Intergenic
1060990350 9:127845389-127845411 AAGATCTGGATGAGGACTTCTGG + Intronic
1062173769 9:135149474-135149496 GAGCTCAGGGTGAGGCCTGGGGG + Intergenic
1062184908 9:135213034-135213056 GAGTTCAGGCTGGAGACTGGAGG + Intergenic
1185929102 X:4182210-4182232 GAAATGAGGCTGAGACCTGCTGG - Intergenic
1190255821 X:48761688-48761710 GGGCACAGGCTGAGGACTGTGGG - Intergenic
1191090597 X:56616563-56616585 GAGATCATGCTGACAACTGAAGG + Intergenic
1192317228 X:70062446-70062468 TAGGACAGGCTGAGGACTTCTGG + Intergenic
1192560117 X:72122828-72122850 GAGACCTGACTGAGGACTGATGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195244506 X:102983396-102983418 GGGAACTGCCTGAGGACTGCAGG + Intergenic
1197727429 X:129785766-129785788 CAGATCAGGCTGAGGGTTGGTGG + Intronic
1198735159 X:139776601-139776623 GAGATCAGGTTGGGGTATGCTGG - Intronic
1199394805 X:147323321-147323343 GAAATAAGGCTGAGACCTGCTGG + Intergenic
1202151694 Y:21849598-21849620 GAGAACATGCTGAGGCATGCTGG - Intergenic