ID: 1170983610

View in Genome Browser
Species Human (GRCh38)
Location 20:21238275-21238297
Sequence CATCATGTACTTGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170983608_1170983610 -7 Left 1170983608 20:21238259-21238281 CCTCACTTCTGTATGGCATCATG 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1170983610 20:21238275-21238297 CATCATGTACTTGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 149
1170983607_1170983610 -6 Left 1170983607 20:21238258-21238280 CCCTCACTTCTGTATGGCATCAT 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1170983610 20:21238275-21238297 CATCATGTACTTGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170983610 Original CRISPR CATCATGTACTTGAGCTGCA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900294472 1:1942030-1942052 CGGCAGGAACTTGAGCTGCACGG + Exonic
901369553 1:8784998-8785020 GATCATGTTCTTGAGCTGTGTGG - Intronic
901772055 1:11535500-11535522 CATCATGTACTGGAGCGGCTGGG + Exonic
902196393 1:14801632-14801654 GTTTATGTACTTGGGCTGCAAGG + Intronic
908081646 1:60586315-60586337 CATCATACACTAGAACTGCAGGG + Intergenic
912499797 1:110114263-110114285 CATCCTGTCCTTGGCCTGCAGGG + Intergenic
912747464 1:112257229-112257251 CATCATGGTGTTGAGCTGTATGG - Intergenic
916704588 1:167335892-167335914 TAACATGGATTTGAGCTGCATGG + Intronic
918766262 1:188487617-188487639 CAACCTGGATTTGAGCTGCATGG + Intergenic
921269200 1:213452121-213452143 AATCTTGTTCTTGAGCTACAAGG + Intergenic
921541489 1:216421878-216421900 CATCATTTACCTTAGCTGTATGG - Exonic
922562442 1:226579055-226579077 CATGATGCACTTGACCTGTATGG + Intronic
922793313 1:228322717-228322739 CAACATGCATTTGAACTGCATGG - Intronic
922939914 1:229454038-229454060 CAACATGAGCTTGAACTGCATGG - Intronic
1067171900 10:43913860-43913882 CATCCTGGACTTGAGCCTCAGGG + Intergenic
1068294419 10:55051231-55051253 CATAATGCAGTTGAGCTGTAAGG - Intronic
1068753931 10:60629136-60629158 TAACATGTACCTGAGCTGCTAGG + Intronic
1075060583 10:119254170-119254192 CATCCAGTACTTGAGTTGTAGGG + Intronic
1077059911 11:613545-613567 CATCATGTACAAGGGCCGCACGG - Exonic
1077103989 11:833953-833975 CATCATGGAATGGAGCTGGAGGG - Intronic
1080221011 11:29904215-29904237 CAACATGGATTTGAGCTTCATGG + Intergenic
1081925988 11:46829144-46829166 CAACATGGATTTGAACTGCACGG + Intronic
1085027708 11:73246622-73246644 CATCATGGGCTTGAACTGCATGG + Intergenic
1090168739 11:124579517-124579539 CAACATGGGCTTGAACTGCATGG - Intergenic
1090906660 11:131082125-131082147 CAACATGAGTTTGAGCTGCAGGG - Intergenic
1091371275 11:135060834-135060856 CAACATGGATTTGAACTGCATGG - Intergenic
1093673754 12:21908974-21908996 AATTATATACTTGAACTGCATGG - Intronic
1094675849 12:32619690-32619712 CAACATGTTGTTGAACTGCAAGG - Exonic
1097601916 12:61703570-61703592 CATGAAGCACTGGAGCTGCATGG - Intergenic
1098306913 12:69111493-69111515 CAACATGGATTTGAACTGCAAGG + Intergenic
1099436927 12:82657006-82657028 CCTGATGGACTTGAGCTGAAGGG - Intergenic
1100410268 12:94310680-94310702 CAACATGGGCTTGAACTGCATGG - Intronic
1101287582 12:103331400-103331422 CATCAGCTACTTCAACTGCAAGG + Intronic
1101705051 12:107213910-107213932 CATCATTTTCTAGGGCTGCATGG - Intergenic
1102780788 12:115562748-115562770 CATCATGACCTTGAGCAGCCTGG - Intergenic
1106220000 13:27738541-27738563 CAACATGGATTTGAACTGCATGG + Intergenic
1112557222 13:100479717-100479739 CAACATGGATTTGAACTGCATGG - Intronic
1113111206 13:106825873-106825895 CATTATTTGCTTGAACTGCAAGG + Intergenic
1115204371 14:30886287-30886309 CATCATGTGCAGCAGCTGCAGGG - Exonic
1116807777 14:49510395-49510417 CATAATGGACTTTAGCTCCATGG + Intergenic
1117348753 14:54860190-54860212 CAACATGAATTTGAACTGCATGG - Intronic
1118138891 14:63057722-63057744 CATCATGGATTTGAACTGTAGGG + Intronic
1118711593 14:68523831-68523853 CAACATGGACTTGAACTGCCTGG - Intronic
1120695053 14:87635551-87635573 CAGCATGGATTTGAACTGCATGG - Intergenic
1120992029 14:90385400-90385422 AATCATATACTAGAGCTGGAAGG - Intergenic
1121108360 14:91295542-91295564 GATCATGGACTTGGGCTGAAGGG - Intronic
1121954158 14:98198768-98198790 CATAATGCACTAGAGGTGCAAGG + Intergenic
1122391499 14:101390627-101390649 CAACATGGGTTTGAGCTGCATGG + Intergenic
1124228936 15:27924353-27924375 CAACATGGATTTGAACTGCATGG - Intronic
1125063307 15:35451384-35451406 CATTTTGTACTCTAGCTGCATGG + Intronic
1126450321 15:48801344-48801366 CATCATGTATTTTAGAGGCAAGG - Intronic
1127534329 15:59875723-59875745 CATCATTTTCTATAGCTGCATGG - Intergenic
1134328439 16:13228418-13228440 CATCATGTATTGAAGCTGCTGGG + Intronic
1140451378 16:75073711-75073733 CATCATGTACATGCTCTGCGGGG + Intronic
1142322428 16:89392559-89392581 GACCATGTTCTTGAACTGCATGG - Intronic
1149109919 17:53016303-53016325 CATGATGTGCTTGAACTGTATGG - Intergenic
1149287359 17:55179534-55179556 CAACATGAATTTGAACTGCATGG + Intergenic
1151909256 17:77071035-77071057 CAGCTTGTACTGGAGCCGCATGG - Intergenic
1152000234 17:77640739-77640761 CATCCTGCATTTAAGCTGCAAGG - Intergenic
1203189293 17_KI270729v1_random:163981-164003 CATCATGTAATTGAAATGAATGG - Intergenic
1154054486 18:10999929-10999951 CTTCATGTACTTAACCTACAAGG - Intronic
1158473564 18:57759964-57759986 CATCATGTAGGAGAGCTGCTAGG + Intronic
1159501958 18:69283325-69283347 AAAAAAGTACTTGAGCTGCATGG + Intergenic
1162105321 19:8366596-8366618 CTTGAGGGACTTGAGCTGCAGGG + Intronic
1162322193 19:9977062-9977084 CAGAAGGTACTTGAGCTGCCTGG - Intronic
1167539764 19:50078020-50078042 CATCATGTTTTTGAGATGCAGGG - Intergenic
1167629944 19:50619763-50619785 CATCATGTTTTTGAGATGCAGGG + Intergenic
926361118 2:12088492-12088514 CATCTTGGACTTGCTCTGCATGG - Intergenic
930856979 2:56029627-56029649 CATCATGTGCTTGGGCTCCCTGG + Intergenic
942415368 2:175753104-175753126 CAACATGGATTTGAACTGCATGG + Intergenic
942670531 2:178370758-178370780 AATCATATACTTGATCTGGAGGG - Intronic
944305322 2:198172395-198172417 CATCATCTAAATGAGCTGCTTGG - Intronic
944515325 2:200507462-200507484 CAGCATGGAATTGAGCTGCTAGG + Intronic
945997249 2:216447977-216447999 TATCATGTACTTGCACAGCAAGG - Intronic
947608186 2:231503969-231503991 TCTCCTGTGCTTGAGCTGCATGG - Intergenic
947699697 2:232222320-232222342 GATCAAGTACTTGAGTTGCCTGG - Intronic
1170983610 20:21238275-21238297 CATCATGTACTTGAGCTGCAGGG + Intronic
1175049455 20:56140869-56140891 CATCATGTCCTTGATAAGCAGGG - Intergenic
1175305917 20:57975522-57975544 CATGTTGGACTTGAGGTGCAGGG - Intergenic
1182856292 22:33520392-33520414 CATCCTGTACCTGAGATTCATGG + Intronic
1184462134 22:44645089-44645111 CAACATGGACTTGAACTGCTTGG - Intergenic
1184797494 22:46740571-46740593 CATCCTGCAGTTGAGTTGCATGG + Intergenic
1203327903 22_KI270738v1_random:45685-45707 CATCATGTAATTGAAATGAATGG + Intergenic
952100199 3:30002214-30002236 TATCAAGTACTTGAGCTTGATGG + Intronic
959320982 3:104875502-104875524 GATGATGTACTTGAGGTGGAAGG - Intergenic
959761003 3:109965152-109965174 CAACATGGAGTTGAACTGCATGG + Intergenic
960077580 3:113505225-113505247 CAACATGAGTTTGAGCTGCACGG - Intronic
963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG + Intergenic
964775567 3:160272912-160272934 GTTTATGTACTTTAGCTGCAGGG - Intronic
965061839 3:163793803-163793825 CAGCATGGATTTGAACTGCATGG - Intergenic
965584221 3:170301433-170301455 CTTCATATATTTGAGCTGCTTGG - Intronic
966841432 3:184091687-184091709 CATCATGGGTTTGAACTGCAAGG + Intergenic
968151815 3:196343019-196343041 AATCATGTACTTGAGATAAACGG + Intergenic
968345186 3:197998135-197998157 GCTCTGGTACTTGAGCTGCATGG - Intronic
970696644 4:18685866-18685888 CATCATGGCCTTGAGCTTCTGGG + Intergenic
971086869 4:23288506-23288528 CAACATGGATTTGAACTGCATGG - Intergenic
974630031 4:64477620-64477642 CATCATGAACTAGAGTTGGATGG - Intergenic
975722915 4:77265608-77265630 CATCATGTTGTCTAGCTGCAAGG + Intronic
976982818 4:91253058-91253080 CAGCATGGGCTTGAACTGCATGG + Intronic
978193147 4:105939379-105939401 CACCCTGTACTTGAGCTACATGG - Intronic
984973482 4:185210108-185210130 CAGCCTGTACCTGAGCTGCGCGG + Intronic
986376048 5:7131991-7132013 CATTATGTATTTGAGCTGACTGG - Intergenic
986998375 5:13633358-13633380 CAGCATGGCTTTGAGCTGCAGGG - Intergenic
987207324 5:15640948-15640970 CAGCATGTCCTTAAGCTACACGG - Intronic
988413409 5:30915405-30915427 CAGCATGAACTTGAGCTGTGTGG - Intergenic
988444086 5:31265651-31265673 AAACATGTTCTTGATCTGCATGG + Intronic
990658928 5:57990693-57990715 AAAGATGTACTTGACCTGCAGGG + Intergenic
992649431 5:78843207-78843229 CCTGATGTACTTGAACTGAATGG + Intronic
995953538 5:117746477-117746499 CAGCATGTACTTGAGGAGTAAGG - Intergenic
998458522 5:142292382-142292404 CTTGATGTACTTGACCTTCAAGG - Intergenic
1000148578 5:158477477-158477499 CATCTTGGACTTGAGCTGAGTGG - Intergenic
1001161249 5:169316943-169316965 TATTATGTACATTAGCTGCAGGG - Intergenic
1004917205 6:20342991-20343013 CATCAGGTGCTTGAGCCCCAAGG - Intergenic
1010398608 6:75422165-75422187 TAACATGTACTTGAGGTTCAAGG - Intronic
1010987161 6:82438064-82438086 CATTCTGAACTTGATCTGCATGG - Intergenic
1012167726 6:95979653-95979675 AATCATGTATTTCAGCTGAATGG - Intergenic
1013940424 6:115654636-115654658 CAACATGGGCTTGAACTGCATGG + Intergenic
1013986981 6:116206170-116206192 CATCATGGAATTGCCCTGCATGG - Intronic
1015168667 6:130227129-130227151 CATCAGGGACTAGGGCTGCAGGG - Intronic
1015771726 6:136774780-136774802 CATTAGGTACTAGAGGTGCAGGG + Intronic
1016427080 6:143946222-143946244 CAACATGAGTTTGAGCTGCACGG - Intronic
1019917484 7:4143177-4143199 CACCCTGTCCTGGAGCTGCAGGG + Intronic
1022829745 7:34053847-34053869 CAACATGGATTTGAACTGCATGG - Intronic
1023425223 7:40028999-40029021 CATCATGGGTTTGAGCTGCATGG + Intronic
1025558728 7:62343183-62343205 CATCATGTAATTGAAATGAATGG + Intergenic
1026053719 7:66967400-66967422 CATCATCATCTTGAGGTGCAGGG - Intergenic
1027347362 7:77275106-77275128 CAACATGGATTTGAACTGCATGG + Intronic
1029165561 7:98587275-98587297 CAACATGGACTTGAACTGCATGG - Intergenic
1030191038 7:106810243-106810265 CATCAAGTACTTGCGCTTTATGG - Intergenic
1031839094 7:126715678-126715700 CAACATGGATTTGAGCTGCATGG - Intronic
1037638007 8:20717953-20717975 CAGAAGGGACTTGAGCTGCATGG - Intergenic
1038302369 8:26364759-26364781 CAACATGGATTTGAACTGCATGG + Intronic
1038629508 8:29227873-29227895 CATCATGTACTTGAACTCCTGGG - Intronic
1041180031 8:55237585-55237607 CAACATGTGCTTGAACTGCATGG - Intronic
1041863801 8:62545102-62545124 CAACATGGGTTTGAGCTGCATGG - Intronic
1042054293 8:64747639-64747661 CAACATGGATTTGAACTGCACGG - Intronic
1044899431 8:96928061-96928083 CATGATGAACTTCAGCTGTACGG - Intronic
1047631977 8:126717634-126717656 TATCATGTACTTCAACTGCTAGG - Intergenic
1048910193 8:139127761-139127783 CATCAGGGACTTGGGATGCAGGG - Intergenic
1049390681 8:142368736-142368758 CTTCCTGTCTTTGAGCTGCAGGG - Intronic
1049473622 8:142787088-142787110 CAGAAGGTCCTTGAGCTGCAAGG + Intergenic
1050224253 9:3433172-3433194 CAACATGGGCTTGAGCTACATGG - Intronic
1050499884 9:6286176-6286198 CAAAATCTACATGAGCTGCAAGG + Intergenic
1052728698 9:32260869-32260891 CAACATGGATTTGAACTGCATGG - Intergenic
1055497894 9:76873681-76873703 CATCATGGGTTTGTGCTGCAAGG - Intronic
1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG + Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1059851836 9:118350423-118350445 CATTATTTAGTTCAGCTGCAAGG - Intergenic
1061036983 9:128119382-128119404 CTCCAGGTACTTGGGCTGCAGGG - Intergenic
1062533499 9:137011735-137011757 GACCAGGTAGTTGAGCTGCAGGG + Exonic
1203365498 Un_KI270442v1:251419-251441 CAGCATGTACTAGACCTGGAAGG - Intergenic
1186381402 X:9064008-9064030 CAACATGGGCTTGAACTGCATGG + Intronic
1186900781 X:14053205-14053227 CAACATGGATTTGAACTGCAAGG - Intergenic
1189081293 X:37975368-37975390 CAGCATGTACTGGAGCAGCAGGG + Intronic
1190457849 X:50643097-50643119 CATCTTGGCCTAGAGCTGCATGG - Intronic
1190549590 X:51565058-51565080 CAACATGGGCTTGAACTGCATGG - Intergenic
1190720372 X:53142950-53142972 CATGATGAACTTGATCTTCATGG + Intergenic
1190847422 X:54207184-54207206 AATAATGTACTTGTTCTGCAAGG - Intronic
1191165063 X:57380730-57380752 AAAAATGTACTTGAGCTGCAAGG - Intronic
1191899391 X:66025076-66025098 CATCATCTCCTTGTGCTGTATGG - Exonic
1198504947 X:137292141-137292163 CAGCAAGCACTTGAGCTGCAGGG - Intergenic
1200232896 X:154453424-154453446 CATCATGTTTTTGAGGTTCATGG + Intergenic