ID: 1170991025

View in Genome Browser
Species Human (GRCh38)
Location 20:21302066-21302088
Sequence TTACCTGGAAGCAGCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170991025_1170991031 22 Left 1170991025 20:21302066-21302088 CCAGAGGGGCTGCTTCCAGGTAA No data
Right 1170991031 20:21302111-21302133 ATAATACTTTGGAATAGTTTTGG No data
1170991025_1170991029 11 Left 1170991025 20:21302066-21302088 CCAGAGGGGCTGCTTCCAGGTAA No data
Right 1170991029 20:21302100-21302122 TCACCATAGACATAATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170991025 Original CRISPR TTACCTGGAAGCAGCCCCTC TGG (reversed) Intergenic
No off target data available for this crispr