ID: 1170991148

View in Genome Browser
Species Human (GRCh38)
Location 20:21303109-21303131
Sequence CGCGCTCGGCCTCGCGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 153}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170991138_1170991148 16 Left 1170991138 20:21303070-21303092 CCCGGCAGAGCAGTCGCCCGTGA No data
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991143_1170991148 -9 Left 1170991143 20:21303095-21303117 CCCCGCAACTCAGACGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991145_1170991148 -10 Left 1170991145 20:21303096-21303118 CCCGCAACTCAGACGCGCTCGGC 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991139_1170991148 15 Left 1170991139 20:21303071-21303093 CCGGCAGAGCAGTCGCCCGTGAG No data
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991137_1170991148 17 Left 1170991137 20:21303069-21303091 CCCCGGCAGAGCAGTCGCCCGTG No data
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991141_1170991148 -1 Left 1170991141 20:21303087-21303109 CCGTGAGCCCCCGCAACTCAGAC 0: 1
1: 0
2: 0
3: 5
4: 140
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991135_1170991148 27 Left 1170991135 20:21303059-21303081 CCCGGCGGAGCCCCGGCAGAGCA No data
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991136_1170991148 26 Left 1170991136 20:21303060-21303082 CCGGCGGAGCCCCGGCAGAGCAG No data
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991140_1170991148 0 Left 1170991140 20:21303086-21303108 CCCGTGAGCCCCCGCAACTCAGA 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153
1170991142_1170991148 -8 Left 1170991142 20:21303094-21303116 CCCCCGCAACTCAGACGCGCTCG 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG 0: 1
1: 0
2: 4
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170991148 Original CRISPR CGCGCTCGGCCTCGCGCTCC GGG Intergenic
900237398 1:1599317-1599339 GGCGGGCGGCCTCGCGCTTCAGG + Exonic
900287500 1:1908665-1908687 CGCGCTGGGGCACGCGCTGCAGG + Intergenic
900349445 1:2227819-2227841 CGCGCTCGGCTCCGCTCGCCCGG - Intergenic
901016836 1:6236616-6236638 CGCACTTGGCCCCGCGCCCCAGG - Intergenic
902410054 1:16207115-16207137 CGCCCTCGGCCTCGTCCCCCGGG + Exonic
902916713 1:19644172-19644194 CGCGCGCGGCCTCTCCCTCCGGG - Intronic
903907189 1:26695881-26695903 CGCGCTCTGACTCTGGCTCCCGG + Intergenic
904171095 1:28592619-28592641 CGGGCTCGGGCTCCGGCTCCGGG - Intronic
904245048 1:29181692-29181714 AGCGCTCCACATCGCGCTCCCGG + Exonic
906637093 1:47416894-47416916 CGCGCCCGGCCCCGCGCTGCTGG + Exonic
911208557 1:95117314-95117336 CGGGCTCCGGCTCCCGCTCCGGG - Intergenic
919878905 1:201889368-201889390 CGCGCTCGGCCCCACTCCCCCGG - Intronic
923140807 1:231160904-231160926 GGCGCTTGGCGACGCGCTCCTGG - Intergenic
923505204 1:234599901-234599923 CTCGCTCGGCCTCGCCCAGCAGG + Intergenic
1063418296 10:5890461-5890483 CGAGCCCAGCCTCGCGCCCCCGG - Intronic
1064086698 10:12350501-12350523 CGGGCTCGGCCGCACGCGCCGGG + Intronic
1064645314 10:17454097-17454119 CGCGCCCCGCCTGGCGCCCCCGG - Intronic
1067572916 10:47384641-47384663 GGCGCCCGACCTCTCGCTCCTGG + Intergenic
1070544072 10:77438999-77439021 TGGGCTCGGCCTCGGCCTCCCGG - Intronic
1070800736 10:79243208-79243230 CGCGCTCTGCGCCGCGCTCGCGG - Intronic
1070895766 10:79982110-79982132 CGCGCTCGCTCCCGCCCTCCTGG + Intronic
1073491471 10:103855685-103855707 CGCTCTCCGGCTCGGGCTCCGGG + Intergenic
1076149503 10:128150757-128150779 CGCGCAGGGCCACGCGCTCGAGG - Intergenic
1076324204 10:129608789-129608811 CGCGCTGGGCCTCCTGCCCCTGG - Intronic
1077008377 11:369544-369566 CGCTCCCGGCTCCGCGCTCCTGG - Intergenic
1077048059 11:554941-554963 CGCGCCCTCCCTCGCGGTCCCGG + Exonic
1077121565 11:911122-911144 CGCGCGGGGCCTTGGGCTCCAGG + Intronic
1078104804 11:8351775-8351797 CCACCTCGGCCTCGCACTCCTGG + Intergenic
1081678075 11:44982628-44982650 CTGTCTCGGCCTCCCGCTCCAGG - Intergenic
1082167973 11:48968633-48968655 CGCGCGCGGCCTGGTGGTCCCGG + Intergenic
1082235568 11:49817986-49818008 CGCGCACGGCCTGGTGGTCCCGG - Intergenic
1082243111 11:49891776-49891798 CGCGCGCGGCCTGGTGGTCCCGG + Intergenic
1082657613 11:55872601-55872623 CGCGCGCGGCCTGGTGGTCCCGG + Intergenic
1083693760 11:64428884-64428906 CGCTCTCGTCCTCACCCTCCCGG + Intergenic
1083952043 11:65961948-65961970 CGCGCTCGCCCCCACGTTCCCGG - Exonic
1084946884 11:72643112-72643134 CGCGGTGGGACCCGCGCTCCGGG + Intronic
1089398873 11:118153064-118153086 CGCACCCCGCCTCGCGGTCCCGG + Intergenic
1089432519 11:118436149-118436171 CGCGCTCTGCTCCGGGCTCCCGG + Intergenic
1089729427 11:120511430-120511452 CTCGCTCGGCCCCGGGCCCCCGG + Intergenic
1090285603 11:125496309-125496331 CGCGCTCGTGCCCGGGCTCCGGG + Exonic
1090803702 11:130189790-130189812 CGCGCTCGGCCTCCTCCACCAGG - Exonic
1091225979 11:133956629-133956651 CGCCCTCGGCCCCTCGCGCCCGG - Intronic
1091718333 12:2795311-2795333 CGTGCCCGGCCGCGGGCTCCGGG - Intronic
1092659377 12:10722627-10722649 CGCGCTGCGCCCTGCGCTCCTGG - Intronic
1095465238 12:42483019-42483041 TGAGCTCGGCCTCTGGCTCCTGG - Intronic
1096021602 12:48329857-48329879 GGCTCTCGGCCTTGCCCTCCTGG - Exonic
1096870328 12:54588603-54588625 CGCGCTCGGCTCCCGGCTCCCGG + Exonic
1101999883 12:109550709-109550731 CTCACTCGGCCTCAAGCTCCTGG + Intergenic
1104854294 12:131894878-131894900 CTCGCCCGGCCCCGCGCCCCCGG + Exonic
1104854300 12:131894892-131894914 CGCCCCCGGCCCCGCGCCCCCGG + Exonic
1107654060 13:42574153-42574175 CCCGCTCGCCCGCGCGCCCCAGG + Exonic
1113369330 13:109708201-109708223 CCCGCTGGGCCTCAGGCTCCCGG - Intergenic
1113984769 13:114304816-114304838 CGCGCTCGGAAGCGAGCTCCTGG - Exonic
1121050462 14:90816381-90816403 CGGGCTCGGGCTCCGGCTCCCGG + Exonic
1121183561 14:91947663-91947685 CGCGCTCGGCTGCGAGCGCCCGG + Exonic
1121546655 14:94768290-94768312 CGCGGGCGGCCTCGGGCTGCTGG + Exonic
1124712889 15:32030252-32030274 GGCTCTCGGCCTCGCGCCTCTGG - Intergenic
1128119083 15:65133001-65133023 CCCGCTCGGCCTCGCGTTCCCGG + Exonic
1128315143 15:66655205-66655227 CGGGCTCGGCCCCGCTCTGCAGG - Intronic
1131252702 15:90840651-90840673 CGTGCTGGGCCTCATGCTCCAGG + Intergenic
1132752758 16:1466327-1466349 CAGGCTCGGCCTCCCGCACCAGG + Intronic
1133029736 16:3004673-3004695 CGCGCTCGTCCGCCCGCCCCTGG + Intergenic
1135752227 16:25066800-25066822 CGCCCTCGGCCTGGGGCTCCAGG + Intergenic
1136234673 16:28906118-28906140 GGCGCTCGGCCCCGTGCTCCTGG + Exonic
1139896868 16:70294706-70294728 AGCGCTCGGGCACGCGCCCCAGG - Intronic
1141830682 16:86508602-86508624 CGGGCGCGGCCTCTCCCTCCAGG - Intergenic
1144682907 17:17206804-17206826 GGCGCTCGGCCACGCCCTCCAGG + Intronic
1144728280 17:17512572-17512594 CAGCCTGGGCCTCGCGCTCCTGG - Exonic
1148664163 17:49362136-49362158 CCCGCTCGCCCTCGCGCGCTGGG - Intronic
1149626403 17:58083533-58083555 AGCGATCGGCCTCGGGCTGCGGG + Exonic
1149894856 17:60421756-60421778 CGCCCTCGGCCTCGGGTCCCTGG + Intronic
1150904936 17:69327147-69327169 CGCGCGCACCCGCGCGCTCCTGG + Intronic
1151801974 17:76384219-76384241 CGCGCGCGGCTCCGCTCTCCCGG - Intronic
1151802067 17:76384570-76384592 CTGGCTCCGCCCCGCGCTCCCGG - Intronic
1152197233 17:78925037-78925059 GGCGCTCGGCCTCCTGCTGCTGG - Exonic
1154266518 18:12883705-12883727 GGCGCTCGGGCGCGCGCCCCCGG - Intronic
1159586858 18:70289589-70289611 CGGGCTCGGGCTCGGGCTCGGGG + Intronic
1160719666 19:591632-591654 CGCGCCCGGCCTCGCTAGCCCGG - Intronic
1160873221 19:1286305-1286327 CGCGCGCGGCCGCGCTCACCTGG - Exonic
1160873245 19:1286363-1286385 CGCGCCCGGCCTCGCGCCCCCGG + Intronic
1161448007 19:4328748-4328770 CGCACTCGGGGTAGCGCTCCAGG + Exonic
1166100323 19:40567866-40567888 GGCGCTCGGGCTTGAGCTCCTGG - Exonic
1168404318 19:56102974-56102996 CGCCCTGGGCCTTGCACTCCTGG - Intronic
926202629 2:10812684-10812706 GGCGCTCGGCATGGCTCTCCTGG - Intronic
926310268 2:11669895-11669917 CGTGCTCAGCCTGGCGCTCGCGG - Exonic
928093420 2:28390440-28390462 TGCGCTCGCCCGCGCGCTCCCGG + Intergenic
935622843 2:105144150-105144172 TGCGCTGGGCCCCGCGCGCCCGG - Intergenic
936530773 2:113275992-113276014 TGCGCTCGGCCTCGCTCCCGCGG + Intronic
941818767 2:169824898-169824920 CGCGTGCGGCCTGGCGCTTCCGG - Exonic
943559269 2:189441657-189441679 CGCGTTCGGACTCGCCCGCCTGG + Intronic
947119239 2:226799134-226799156 CGCGCGCGCGCGCGCGCTCCTGG - Exonic
947765288 2:232633803-232633825 CGGGCTCGGGCTTGGGCTCCGGG - Exonic
1169059766 20:2652868-2652890 CGCGGTCGGCTACGCGCTGCTGG + Exonic
1169217786 20:3803421-3803443 AGCTCTCGGCGTCGCGTTCCAGG - Exonic
1170557985 20:17531011-17531033 CGCGCTCGGCCTCCAGGTCCCGG + Exonic
1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG + Intergenic
1170999300 20:21396925-21396947 CGCCCGCAGCCCCGCGCTCCTGG + Intronic
1172422067 20:34825762-34825784 CGCGCTCCACCTCGCGCTCCCGG - Intergenic
1173279921 20:41618661-41618683 TGCGCTCGGCCCCGCCCCCCCGG + Intergenic
1174204419 20:48828256-48828278 TGCGCGCGGCCTCGGACTCCCGG - Intergenic
1174475767 20:50794909-50794931 CCCGCTCGGCCCGGCGCTCCTGG + Exonic
1176008422 20:62879460-62879482 CCCGGTCGGCCTCGCGCTCTCGG + Exonic
1176217660 20:63955958-63955980 GGCCCTCGGCCTCGAGCGCCCGG - Intronic
1179375559 21:40847149-40847171 CGCGCTCGGCTTCACTCGCCCGG - Intergenic
1180005376 21:45018413-45018435 CTCGCCCGGCCTCGCCCTCGGGG - Intergenic
1180796802 22:18609832-18609854 CCCGCTGGGACTCGCGCTGCAGG + Exonic
1181224922 22:21385439-21385461 CCCGCTGGGACTCGCGCTGCAGG - Exonic
1181253710 22:21549374-21549396 CCCGCTGGGACTCGCGCTGCAGG + Exonic
1181381539 22:22508545-22508567 CGCGCTTGGCCGTGCGCTGCCGG - Intronic
1182585982 22:31344660-31344682 CGTGCTGGGCCTCGTGCTGCCGG + Exonic
1182903910 22:33920607-33920629 CGCCCCCGGCCCCGCGCCCCAGG - Intronic
1183601715 22:38843926-38843948 CCCGCTCGGCCCAGCGCGCCCGG - Exonic
1183780350 22:39995225-39995247 CCCGCAGGGCCTGGCGCTCCGGG - Exonic
1184253693 22:43275301-43275323 CGCGCTGGGCGTCCCTCTCCTGG + Intronic
1184759604 22:46537173-46537195 CCGGCTCGGGCTCGGGCTCCGGG - Intergenic
1185343070 22:50300107-50300129 GCCCCTCGGCCTCGCGCACCTGG + Intronic
1185351765 22:50343301-50343323 GGCGCACGGGCACGCGCTCCGGG - Exonic
953627246 3:44581056-44581078 CCCGGCCGGCCTGGCGCTCCCGG + Intronic
954275634 3:49539983-49540005 CCCGCTCGGCCCCGCGCTGCCGG - Intergenic
954632661 3:52055743-52055765 CGCGCTCGGCCTGCCCCTCTGGG - Intronic
960639086 3:119809994-119810016 GGCCCTCGGCCTGGGGCTCCGGG - Intronic
960702291 3:120450707-120450729 CGCGCTCGCGCTCGCGCTGGTGG - Exonic
961405880 3:126679306-126679328 CGCGCTCTTCCTCGCGGGCCAGG + Intergenic
961745677 3:129062213-129062235 CGCGCTGGGCCTGGCTCTTCTGG + Exonic
972311932 4:37890651-37890673 CGCGCGGGGCCCCGCGCCCCCGG + Intergenic
972586147 4:40438515-40438537 CGCGCTTGGCCTCGTGCTTGTGG + Exonic
979624101 4:122827021-122827043 CGGGCGCGGCCGCGCGCTGCCGG + Exonic
983296319 4:165873449-165873471 CGCGCTCGGCCGCGGAGTCCTGG + Exonic
985512604 5:321060-321082 TGCTCTCGGCCGCGCGGTCCCGG + Intronic
990553835 5:56910052-56910074 CGAGCTCGGCCTCGCGGGCCCGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
992796036 5:80255877-80255899 TGCGCCCGGCCTCGCTCACCTGG + Exonic
992962697 5:81971959-81971981 CGTGATCGGCCGCGCGCTCTGGG - Intergenic
997692265 5:135834821-135834843 GGCGCTCGGTCTCGCCCTCCCGG - Exonic
998143208 5:139711237-139711259 CGCGCTGGGCTGCGCGCGCCTGG - Intergenic
1001587638 5:172844285-172844307 CCCACAGGGCCTCGCGCTCCAGG - Intronic
1006458169 6:34143752-34143774 AGCGCTCAGCCTCCCGCCCCGGG - Intronic
1007336191 6:41156911-41156933 CGCGGCCTGCCTCGTGCTCCAGG - Intergenic
1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG + Intronic
1011734486 6:90297191-90297213 CCCGCTCGGCCTGGCCTTCCCGG + Intergenic
1014755894 6:125301810-125301832 CCCGCTCGGCCGCGGCCTCCCGG + Intronic
1015525927 6:134175401-134175423 CGCGCGCGACCTCGCCCGCCAGG + Intronic
1015935315 6:138402695-138402717 CGCCCTTGGCCTGGGGCTCCTGG + Intergenic
1017206508 6:151808498-151808520 CGGGCTGGGCCGCGCGCCCCGGG - Intronic
1018612754 6:165661132-165661154 CGCTCTCGGCCCCGCGCCCGCGG + Intronic
1022020948 7:26398827-26398849 CGCGCGCAGCCTGGGGCTCCCGG - Intergenic
1022427874 7:30285291-30285313 CGCGCTCGCTCCCGCCCTCCCGG + Exonic
1023955736 7:44885396-44885418 CGCCCTCCGGCTCGCGCTCCGGG + Intergenic
1024993529 7:55254541-55254563 CCCGCTCCACCTCCCGCTCCCGG + Intronic
1026765066 7:73155107-73155129 CGCGCCCGGCGCCGAGCTCCCGG + Intergenic
1027041539 7:74964862-74964884 CGCGCCCGGCGCCGAGCTCCCGG + Exonic
1027082103 7:75237507-75237529 CGCGCCCGGCGCCGAGCTCCCGG - Intergenic
1029640296 7:101816106-101816128 CGCGCTCGGCCTCGCGCCCGGGG + Intronic
1033365939 7:140672888-140672910 CACGCTCCGCCCCGCCCTCCCGG + Intronic
1035018570 7:155787416-155787438 CGCGCGGAGCCTCGCGGTCCGGG - Intergenic
1036032700 8:4991649-4991671 GGGGCTCGGCAGCGCGCTCCAGG - Intronic
1037305138 8:17496981-17497003 CGGGCTCGGGGTCGCGTTCCGGG + Intergenic
1037980015 8:23246704-23246726 GGGCCTCGGCCTCCCGCTCCGGG - Exonic
1043471327 8:80566035-80566057 CGCGCCCGCCCCCGCGCGCCTGG - Intergenic
1044549461 8:93495924-93495946 CGCGCTCGCCCCCGCTCTGCCGG + Intergenic
1049090603 8:140511254-140511276 CGCGCCGGGCCTCGCACTCGGGG + Intergenic
1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG + Exonic
1049442021 8:142613938-142613960 CGCGCTTGACCCAGCGCTCCAGG + Exonic
1049580256 8:143407757-143407779 CGCGCTAGGCCACGGGGTCCCGG + Intergenic
1049610717 8:143553551-143553573 GGCGCTCGCCCTCTCGCTGCAGG + Exonic
1049619100 8:143589778-143589800 CGGGCTCGGCCCCGCGGACCTGG - Exonic
1049731580 8:144181111-144181133 AGCCCACGGCCTCGTGCTCCCGG + Intronic
1059354433 9:113687927-113687949 TGCGCGGTGCCTCGCGCTCCGGG + Intergenic
1060106522 9:120876579-120876601 CCCGCCCGGCCCCGCGCTCCCGG - Intronic
1061457881 9:130712603-130712625 GGGGCTCGGCCCCGCCCTCCTGG - Intergenic
1062629992 9:137459189-137459211 CGCGCTCGGGCTCGGGCTCGGGG + Exonic
1197746090 X:129932755-129932777 CCGGCTCGGGTTCGCGCTCCCGG - Intergenic
1200066031 X:153504477-153504499 CCCTCTCCGCCTCCCGCTCCAGG + Intronic
1200155385 X:153972223-153972245 CGCGCTCGGCCCCGCCCCCTTGG + Intergenic