ID: 1170993335

View in Genome Browser
Species Human (GRCh38)
Location 20:21326087-21326109
Sequence TTTTATCTGTAGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170993335_1170993337 1 Left 1170993335 20:21326087-21326109 CCATCCACTTTCTACAGATAAAA 0: 1
1: 0
2: 1
3: 42
4: 363
Right 1170993337 20:21326111-21326133 ATCTGCTTCAGTTTGCTTTAAGG 0: 1
1: 0
2: 4
3: 18
4: 255
1170993335_1170993338 29 Left 1170993335 20:21326087-21326109 CCATCCACTTTCTACAGATAAAA 0: 1
1: 0
2: 1
3: 42
4: 363
Right 1170993338 20:21326139-21326161 AATAACTTATTATAATTTAAAGG 0: 1
1: 0
2: 3
3: 86
4: 860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170993335 Original CRISPR TTTTATCTGTAGAAAGTGGA TGG (reversed) Intronic
900508218 1:3040802-3040824 TTTTATCTCTGGAAAAAGGATGG - Intergenic
903782382 1:25829355-25829377 TGGTATCTGTAGCCAGTGGAGGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908652710 1:66353540-66353562 TTTCATCTATAGCAAGTTGAAGG - Intronic
910114512 1:83717161-83717183 TTTTATCTGAACACACTGGATGG + Intergenic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
911390402 1:97233831-97233853 TTTTAGCTGTATACAGTGGGAGG + Intronic
912216603 1:107620799-107620821 TTTTAGCTGATGAAAGTGTATGG + Intronic
916459514 1:165008878-165008900 TGTCATTTGTGGAAAGTGGAAGG - Intergenic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
918284483 1:183038525-183038547 TTCTCTCTGAAGAAAGTTGATGG - Intronic
918332803 1:183475347-183475369 TTTTATCTGGACAAAGTGGTCGG + Intronic
918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG + Intergenic
918723721 1:187890093-187890115 TATTATCTGTAGAATTTTGAAGG + Intergenic
918845029 1:189598556-189598578 CTATATCTGTATAAAGTAGATGG + Intergenic
918874418 1:190021061-190021083 TTTTCTCTGTAGGAAGATGATGG + Intergenic
919369883 1:196709711-196709733 TTTTATCTATAGAAAGGAAAAGG - Intronic
919382454 1:196875735-196875757 TTTTATCTGTAGAAAAGAAAAGG - Intronic
919675647 1:200380078-200380100 TTTTATATGTAGAGAGAGAAAGG + Intergenic
919719661 1:200819633-200819655 TTTAATCTGTAAAAATTAGAAGG + Intronic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920929761 1:210376391-210376413 TTTTAGCTGTCGTTAGTGGAGGG + Intronic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921476205 1:215613670-215613692 TTTTGTATGTAGTAAGAGGAAGG + Intronic
922531413 1:226348133-226348155 TTTTATCTGTTGGAGCTGGAAGG - Intergenic
922818080 1:228465222-228465244 TTTTAACTGGAGAAATTGAATGG + Intergenic
923094522 1:230763991-230764013 TTTTATGTTTAGAAACTAGATGG - Intronic
923292652 1:232561636-232561658 TTCTATCTGTAGAATAAGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
923980398 1:239315394-239315416 TTTTAGCCATAGAAAGTGGTGGG + Intergenic
924363290 1:243263516-243263538 TTTTATCAGTGGAAAGTGACAGG + Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924520071 1:244798365-244798387 TTTTCTTTGTAAAAAGAGGAGGG - Intergenic
1063078252 10:2738510-2738532 TTTTAAAAATAGAAAGTGGAAGG + Intergenic
1063761479 10:9083456-9083478 TTTGCTCTGCACAAAGTGGAAGG - Intergenic
1064055385 10:12092853-12092875 TTTTATCTGTGGAAATTGGTAGG + Intronic
1065758255 10:28955347-28955369 TTTTGTCTGTAATAAGTTGATGG - Intergenic
1066814233 10:39383137-39383159 TTTTTTCTGTAGAATCTGCAAGG - Intergenic
1067042916 10:42966301-42966323 TTTTTTCATTTGAAAGTGGAAGG + Intergenic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069395885 10:67987287-67987309 TTTTACCTCGAGAAAATGGAAGG - Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1072012469 10:91314744-91314766 TTTTATTTGTAGAAATTGTTTGG + Intergenic
1072219129 10:93312929-93312951 TTTTATCTGGAGTAAGTCTATGG + Intronic
1072962203 10:99939606-99939628 GTTTAGTTTTAGAAAGTGGAAGG - Intronic
1073234419 10:102001656-102001678 TCTTATGTGTGGGAAGTGGAGGG - Intronic
1074285016 10:112089941-112089963 TTTAATCTGTAAAAAGAAGAGGG - Intergenic
1074500347 10:114017976-114017998 TCTATTCTGTAGGAAGTGGAGGG - Intergenic
1074571747 10:114631016-114631038 TTTTATCTCTAGAGAGGAGAGGG + Intronic
1075632486 10:124009499-124009521 TTACATCTGAAGAAACTGGAGGG + Exonic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1077196147 11:1281371-1281393 TTTTCACTGAGGAAAGTGGACGG + Intronic
1077803460 11:5565792-5565814 TTTTCTGAGTAGCAAGTGGATGG + Intronic
1078265140 11:9749788-9749810 TTTTGTCTGTAGAAAAATGATGG + Intronic
1079014562 11:16857525-16857547 TTCTGTCTGGAGAAAGGGGATGG - Intronic
1079237864 11:18702415-18702437 TTTCATCTGCACAAAGTTGAGGG + Exonic
1080175551 11:29358566-29358588 TTTTCCCTGAAGAAAGTTGATGG - Intergenic
1080677334 11:34439857-34439879 GGTTATCTGTAGAATGTAGAGGG + Intronic
1080785311 11:35470022-35470044 TTTTATAGGTGGCAAGTGGAGGG + Intronic
1081282456 11:41226445-41226467 ATTTATCTGTAAAAGGTAGATGG - Intronic
1082602702 11:55178833-55178855 TTTTTTTTGTAGAAACTGCAAGG - Intergenic
1082631764 11:55551263-55551285 TTTTATCTGAAATAAGTGGTTGG + Intergenic
1088577010 11:111282152-111282174 TTTTCTCTGTACAAAGAGAAAGG - Intronic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089436652 11:118474476-118474498 TTTGATAGGTAGAAAGTGGCAGG + Intronic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1092646246 12:10576225-10576247 TTTTAGCTGTAGAAATGGGCGGG + Intergenic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1093784304 12:23174905-23174927 TTTTGTCTGTAGGAAATTGATGG - Intergenic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1095453557 12:42357738-42357760 TTTTATTTGTATAAATTTGATGG + Intronic
1095626849 12:44325269-44325291 TTTTCACTGTAGAAAGATGAAGG - Intronic
1095798049 12:46241910-46241932 TTTTCTCTCTACAAAATGGAAGG + Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1098851942 12:75605988-75606010 TTTAATCTGCTGAAAGTGCATGG - Intergenic
1098941892 12:76547464-76547486 TTTTATGAGTAGAAAATGAAAGG + Intronic
1099546695 12:83991249-83991271 GTTTTTCTGTAGAAAGATGATGG + Intergenic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100408987 12:94295894-94295916 TTTTCTCTGTAAAGAGTGCAGGG - Intronic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1100682576 12:96943800-96943822 GTTTATCAGTAGAAAGTGGGTGG + Intronic
1100857739 12:98773011-98773033 TTTAATCTGTTGAAAGGGGGTGG + Intronic
1101006648 12:100407482-100407504 TTTTTTCTGCAGAAACTAGAAGG + Intronic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101988105 12:109462996-109463018 TTTTATTTGTGGAAAATGCAAGG - Intronic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1105665249 13:22548533-22548555 TTTTATCTGTAAAAAGTGTTAGG + Intergenic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1106516000 13:30454496-30454518 TGTTATATATAGAAACTGGAAGG + Intergenic
1107178161 13:37423506-37423528 TTCTACCTGTGGAAAGAGGAGGG + Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1109247488 13:59973827-59973849 TTTTATGTGTAGAGGGTGCATGG + Intronic
1109818841 13:67624371-67624393 TTTTATCTGAAGCTAGTAGAAGG - Intergenic
1110309218 13:74027804-74027826 TTTTATGTGAAGAATGTGTATGG - Intronic
1110810171 13:79803911-79803933 TTTTACCTGGAGAAGGTTGAGGG - Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113031853 13:106001894-106001916 TTTTATTTGTCACAAGTGGAGGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113567997 13:111330527-111330549 TTTTATCTGTAGTCAGAGGAAGG - Intronic
1114351036 14:21851582-21851604 TTTTTTGTGTAGAAAGAGTATGG - Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115170449 14:30499019-30499041 TATTATCTGTAGATAGAAGATGG - Intergenic
1115365621 14:32553724-32553746 TTTTATTTGTGGAAAGGGAATGG - Intronic
1117686616 14:58259995-58260017 TCATATCGGTAGAAAATGGAAGG + Intronic
1118289417 14:64505466-64505488 TTTGTTCAGTAAAAAGTGGAAGG + Intronic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1120006489 14:79363585-79363607 TTTTTTCTTAAGAAAGTAGAAGG - Intronic
1120094520 14:80373870-80373892 TTTTAGCTGAAGTAAGTGGAAGG + Intronic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1122386826 14:101354481-101354503 TTTTATTTTTAGAAAATGCATGG + Intergenic
1122606802 14:102952173-102952195 TTTTTTTTGTAGAGAGTTGAGGG - Intronic
1123996473 15:25721274-25721296 TTTTATGACTAGAAAATGGATGG + Intronic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1125045055 15:35235707-35235729 TTTTAGCTTTTGAAAATGGAGGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125642862 15:41246224-41246246 TCTTCTTTGTAGAAAGTGGGTGG + Intronic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1128936607 15:71751130-71751152 TTTAGCCTGGAGAAAGTGGAAGG - Intronic
1128940023 15:71780477-71780499 TTCTCTCTGTAGAAAAGGGATGG + Exonic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1131188755 15:90295895-90295917 TTTTATTTGTAAAAAGTTAAAGG + Intronic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137764969 16:50971003-50971025 TTTTATCTTTCTAAAGTGGTGGG - Intergenic
1137913507 16:52403471-52403493 TTTTAGCTATAGGAAGAGGAAGG + Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1144333082 17:14241960-14241982 TTTTATTTATATAAAGTGCAAGG - Intergenic
1144370477 17:14585504-14585526 TTTTTTCTGTAGGAGGTGGGAGG + Intergenic
1144674701 17:17154294-17154316 TTTTCTCTGTAGACAAAGGAGGG + Exonic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1149167630 17:53772154-53772176 TTTTATTAGTTGAAAGAGGAGGG + Intergenic
1149214100 17:54334064-54334086 TTTTATCTGAAGAATTTAGAAGG - Intergenic
1149242672 17:54668661-54668683 GTTTATCTGTAAAAAAGGGATGG + Intergenic
1149442604 17:56687511-56687533 TTTTATTTGTAGGAGGTGGTGGG - Intergenic
1152771506 17:82172414-82172436 TTTTATATTTGTAAAGTGGAAGG - Intronic
1153184636 18:2472735-2472757 TTTTGGCTGTGAAAAGTGGAAGG + Intergenic
1154097053 18:11427977-11427999 TACTATCTATAGAAACTGGAAGG + Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155194235 18:23458285-23458307 TCATATCTTTAGGAAGTGGAAGG + Intronic
1155335863 18:24764826-24764848 ATTTATCTGTCTAAAGTGAAAGG + Intergenic
1155387596 18:25296516-25296538 TTTAACCTGTGGAAATTGGAGGG + Intronic
1155758788 18:29537566-29537588 TTTTATTCGTAGAAATTGAAGGG + Intergenic
1156531965 18:37825966-37825988 TTTTATCTAAAGAAAATAGAAGG + Intergenic
1156956635 18:42973873-42973895 TTTTATTTTTAGAAAATTGAGGG + Intronic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157577993 18:48756386-48756408 TTTTATCTGTGAAAAATTGAGGG - Intronic
1158779781 18:60633683-60633705 TTATATCTGTATAAAGAGGTAGG - Intergenic
1159121628 18:64177869-64177891 ATTTATCTTTAGAAAATGAAGGG - Intergenic
1159526971 18:69604871-69604893 TTTTATTTGTATAAATTTGAGGG + Intronic
1159582935 18:70253144-70253166 TTTCAGCTGTATAAAATGGACGG - Intergenic
1161676658 19:5654356-5654378 TCTTTTCTGTAGGAAGTCGAGGG + Exonic
1163302322 19:16455808-16455830 TTTTACCTGGAGCCAGTGGAAGG - Intronic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925825597 2:7845918-7845940 ATATTTCTGTAGAAAGTAGATGG + Intergenic
927709795 2:25317629-25317651 GTTTATCTGTAGTCACTGGAGGG + Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928483865 2:31710092-31710114 TTTTATCTGTCTTCAGTGGAAGG - Intergenic
932787063 2:74615139-74615161 TTTTCTCTGCAGCAAGTGAAAGG - Exonic
933143110 2:78817902-78817924 TTTTCTCTGAAGAATGAGGAAGG + Intergenic
933360658 2:81279452-81279474 TTTTATGTATAGAAAGTGAAAGG + Intergenic
933406808 2:81870964-81870986 ATTCATCTGTCAAAAGTGGAAGG + Intergenic
933494798 2:83036481-83036503 TTTTATCTGTTGTATGTGTAGGG - Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
933637270 2:84721846-84721868 TTTTCTCTCTAGAAAGTCAAAGG - Intronic
933863499 2:86494671-86494693 TTTTATTTGTGTAAAGTGGGTGG + Intergenic
935642437 2:105303893-105303915 TTTTTGCTGAAGAAATTGGATGG - Intronic
935713898 2:105922911-105922933 TTTTATTAATAGAATGTGGAGGG - Intergenic
936964244 2:118111759-118111781 TTTTATCTTGAGAAACTAGATGG + Intergenic
937401802 2:121590541-121590563 TTATATCTGTAGAAAAAAGATGG - Intronic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
938749443 2:134314682-134314704 TTTTAGCTGAAGAAAGAGGAAGG + Intronic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
939472033 2:142634775-142634797 TCTTATGTGTAAAAAGTGGCCGG - Intergenic
939512781 2:143127220-143127242 TTTTCTTTGTATAAGGTGGAAGG - Intronic
940438409 2:153683457-153683479 TTTTATCTTGAGAAAGTTCAAGG + Intergenic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
942379091 2:175369046-175369068 TTTTATAGGTGGAGAGTGGAGGG + Intergenic
942813912 2:180029049-180029071 TTTTATCTGAAGAATGTTGTTGG + Intergenic
945216538 2:207440208-207440230 TTTAATCTATTTAAAGTGGAGGG - Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
947409149 2:229816741-229816763 TTTTAACTGTAGATAGTATAAGG + Intronic
1169079833 20:2790635-2790657 TTTTATTTGTAGAAATTGTTAGG + Intergenic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1170615746 20:17948966-17948988 TTTTCTATATAGAAAGTAGAGGG - Exonic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1173398562 20:42703656-42703678 TTTTCTGTGTAGTAAATGGAAGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174044689 20:47725293-47725315 TTTTATATGTAAATACTGGAGGG - Intronic
1174086440 20:48011629-48011651 TTTTATATGTTCAAAGTGGATGG + Intergenic
1174668567 20:52283828-52283850 TTTTGTCTATAGAAAATAGAGGG - Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1179002440 21:37475311-37475333 TTTTTGCTGTAGAAGGTAGAAGG + Intronic
1180378983 22:12120793-12120815 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1181292174 22:21804351-21804373 TTTTTTCTGTAGAAATTGACAGG - Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1184306677 22:43607670-43607692 TTTCATCTGTTCAAAGTGGAAGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
951373933 3:21889577-21889599 TTTTTTCTGAAGAAAGTTAAGGG - Intronic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
952239215 3:31512489-31512511 TTTTATTTGTATAAAGTTGTGGG + Intergenic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953151693 3:40330910-40330932 TTTTATCTTTGGAAATTGGGTGG + Intergenic
954255873 3:49405529-49405551 TTTCTTCTGTAGAAAGGGAATGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955712525 3:61795333-61795355 TTTAATCTGTAAAAAGTAGGCGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
960103314 3:113767624-113767646 TTTTATTTGTAAAAATTTGAAGG + Intronic
960781710 3:121326677-121326699 TTATAACTGTAGAAAGTGAGAGG - Intronic
961135655 3:124508070-124508092 TTTTATCTATAGAAATAAGATGG - Intronic
961954014 3:130782022-130782044 TTGTATATGTAGAGAGTAGAAGG + Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
963523515 3:146386720-146386742 TTATATATGTAGAAAGTGGGTGG + Intergenic
963553003 3:146748095-146748117 TTTAATCAGGAGAAAGTAGAGGG + Intergenic
964046080 3:152328923-152328945 TTTAATCTGTTGAAAACGGAAGG + Intronic
964567588 3:158074389-158074411 TGTTATTTATAGGAAGTGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965096565 3:164236206-164236228 TGTTATCTGGAGAAAGTAAATGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965247817 3:166297573-166297595 TTATATCTATAGGAAGTGTATGG + Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
966364311 3:179166370-179166392 CTTTATGGGTAGAAAATGGAGGG - Intronic
966509631 3:180747482-180747504 TATTATGTGTAGTAAGTGGTAGG - Intronic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
967483679 3:190004873-190004895 TTTTAGCTGTAGTAAATTGATGG - Intronic
967521794 3:190440615-190440637 TTTTCTCCTTAGAAATTGGAGGG + Intronic
970299903 4:14670176-14670198 GATTATCTGTAGAAATAGGATGG - Intergenic
970782226 4:19751559-19751581 TTTTAGCTGTCACAAGTGGAGGG + Intergenic
971683730 4:29736449-29736471 ATTTATCTGTAAACAGTGGTAGG - Intergenic
971953416 4:33383533-33383555 TTTCAACTGTGGGAAGTGGAAGG - Intergenic
972071661 4:35027222-35027244 TTTTAGCTGTAGGAATTTGATGG + Intergenic
972297616 4:37755180-37755202 TGTTATTTGTAAAAAATGGAAGG + Intergenic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
972936266 4:44139611-44139633 TTTTATCTGTAATAACAGGAAGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
973159831 4:47001725-47001747 TTCTATCTGTAGAAATTTTAAGG - Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973341072 4:49005209-49005231 TTTTATCTGTATAAATTTGTGGG + Intronic
974336846 4:60558883-60558905 TTTTATCTGTAGGAAGAGGCAGG + Intergenic
975515158 4:75239357-75239379 TGGTCTCTGTAGAAAGAGGAGGG - Intergenic
975601451 4:76104250-76104272 CTTTAGCTGTAGAACCTGGAAGG - Intronic
977337582 4:95718091-95718113 TCAAATCTGTAGATAGTGGAGGG - Intergenic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977503511 4:97872643-97872665 TTTAATCTGTATAAAATGAATGG + Intronic
977522932 4:98108749-98108771 TTTTATCAGTAAAAAATGCAAGG - Intronic
977544751 4:98364336-98364358 TTTTATCTGTAAAATTTGGCAGG - Intronic
977704772 4:100058968-100058990 TTTTGTCTCTAGATAGTGTAAGG + Intergenic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
979135589 4:117108219-117108241 TTACATCTATTGAAAGTGGATGG - Intergenic
980259585 4:130431327-130431349 TTTTCTCTGTCCACAGTGGAAGG + Intergenic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
981735717 4:147948214-147948236 TATTATCTTTAAAAAGTGGCAGG - Intronic
982136307 4:152277243-152277265 TTTCTTCTGTAGGAAGTGAATGG - Intergenic
982209949 4:153026434-153026456 TTTTAGCTGTACATAGTGGGAGG - Intergenic
982547513 4:156753527-156753549 TTTTCTCTGTTGCAAGTAGAGGG + Intergenic
982675917 4:158375597-158375619 GTTTATCTTTAAAAAATGGATGG - Intronic
983973018 4:173897297-173897319 TTTTGTTTGTAGAAAGGGCATGG - Intergenic
1202760601 4_GL000008v2_random:106272-106294 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
987496524 5:18652549-18652571 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
988641693 5:33047775-33047797 TTTTAGCTGTAGAAACTAAAGGG - Intergenic
989217037 5:38916319-38916341 ATTCATCTTTAGAAAATGGATGG - Intronic
989288333 5:39730380-39730402 TTTTATCTCTAGAAACTGACTGG + Intergenic
989288460 5:39732201-39732223 TTTTATCTATAAAAAGGGAATGG + Intergenic
989446228 5:41532714-41532736 TTTTATTTGTAGAGGGTTGACGG - Intergenic
989737143 5:44721484-44721506 TTCTAGATGTAGTAAGTGGAGGG - Intergenic
989753156 5:44919932-44919954 TTGTATCTGTAACAAGTGTATGG - Intergenic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
991366653 5:65875474-65875496 TTTATTCTATAGAAAGTGGTGGG - Intergenic
991385018 5:66077568-66077590 TTTTATTTTTAGAAAGTGTTGGG - Intronic
993777268 5:92014874-92014896 TGGCATCTGTAGTAAGTGGATGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
994226239 5:97254363-97254385 CTTTATCTGTGGAAAAGGGAGGG + Intergenic
994996172 5:107066084-107066106 TATTAACTGAAGAAAATGGAAGG + Intergenic
994996740 5:107073262-107073284 TTTTACCTGCAGAGAGTGCAAGG - Intergenic
995269267 5:110202930-110202952 TTTTATCTCTAAAATGTAGATGG + Intergenic
996931600 5:128896002-128896024 CTTTGCCTGTAGAAAGAGGAGGG - Intronic
997338432 5:133123865-133123887 TTTTCTCTGAAGAATGTTGAGGG + Intergenic
997374591 5:133388214-133388236 ATTTCTCTGTAGAATGTGAAGGG + Intronic
998513757 5:142735004-142735026 ATTTATCTGCAGAAAGGAGAAGG + Intergenic
1000110044 5:158099521-158099543 TGCTGTCTGTGGAAAGTGGAGGG - Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1000758383 5:165189432-165189454 TTGTATATGTAGAACGTGGCTGG + Intergenic
1003255221 6:4469405-4469427 TTTTGTCTGTAACAAGAGGACGG - Intergenic
1005002845 6:21260084-21260106 TTTTAACTGTGGGGAGTGGAGGG + Intergenic
1006144500 6:31950455-31950477 TAGGATCTGTAGAAAGTGGGAGG - Intronic
1006264461 6:32907205-32907227 TTTTATCTGAATAGGGTGGATGG - Intergenic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1007896368 6:45364491-45364513 TTTTGTCTGTATAAGGTGGGGGG - Intronic
1008366426 6:50686166-50686188 TTCTATTTGTAGACATTGGAAGG + Intergenic
1008707497 6:54181243-54181265 TTTTGCCTGTGGAAAGGGGAGGG - Intronic
1009460556 6:63907631-63907653 TTTTATCTGTATAAATTTAAGGG + Intronic
1014472665 6:121835470-121835492 TGTTATGTGAAGAAAGTTGAGGG + Intergenic
1014512502 6:122341578-122341600 TTTCATCTGAAGAAACTGTATGG - Intergenic
1014834522 6:126145868-126145890 TTTAACCTGTAGAAAGTAAAAGG - Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015692325 6:135938808-135938830 TTTTATCCCTAGACAGTAGAGGG - Intronic
1016211484 6:141540090-141540112 TTTTAGCTGTACATAGTGAAAGG - Intergenic
1016291367 6:142531745-142531767 TTTTGTCCTAAGAAAGTGGATGG - Intergenic
1016823827 6:148370085-148370107 TTTTCTCTTTTGTAAGTGGAAGG + Intronic
1018272127 6:162091730-162091752 TTTTATCAGTAGAAAGAAAAAGG + Intronic
1021468747 7:20977326-20977348 TTTAATCTGTAGAAGGGGGTGGG + Intergenic
1022804113 7:33804661-33804683 TTTTATCTGAAGGCAGTGGAAGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024414584 7:49089815-49089837 ATTTATCTGCAGTTAGTGGAAGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024957991 7:54946088-54946110 TATGATCTCTAGAAAGTTGATGG - Intergenic
1028208826 7:88048812-88048834 AATTATCTGTAGAATGTAGAGGG - Intronic
1028610611 7:92706482-92706504 TTTAATCTCTATAGAGTGGAAGG - Intronic
1029015129 7:97308371-97308393 TTTTACATGTAGAAGGTAGAAGG - Intergenic
1029556191 7:101270983-101271005 ATTTATCTGAAGAAAGAGAAAGG + Intergenic
1030185514 7:106758080-106758102 CTTCATCTGTAGTAACTGGAGGG - Intergenic
1030406249 7:109117884-109117906 TTTAATCTGTACAGAGTTGAGGG + Intergenic
1030614539 7:111724935-111724957 TTTTATCTGTACACATTGAAAGG - Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031228752 7:119076576-119076598 TATTTTCTATAGAAAGTAGAGGG + Intergenic
1031256612 7:119459083-119459105 GTTTATAGGTAGCAAGTGGAAGG + Intergenic
1031305800 7:120125185-120125207 TTCTATCATTAGAAAGTGTAAGG + Intergenic
1031797403 7:126193528-126193550 TTTTATTTCTAGAAAGGGCAAGG - Intergenic
1031821319 7:126505544-126505566 TTTTACCTGTACATAGTTGAAGG + Intronic
1032044784 7:128595931-128595953 TTTTAGCTGTAAAAATTAGAAGG - Intergenic
1032072124 7:128814621-128814643 TTTGATCTGTTGGTAGTGGAGGG - Exonic
1032698223 7:134356161-134356183 TTTTGACTGTAGGAAGTTGAGGG + Intergenic
1033457582 7:141516636-141516658 TTAGATATGTAGAAAGTGAAAGG + Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1036611244 8:10351576-10351598 TTATCTCTGTAAAAAGTGAAAGG + Intronic
1038214187 8:25546568-25546590 TGTCACCAGTAGAAAGTGGATGG - Intergenic
1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG + Intronic
1041258672 8:56001281-56001303 TTTGATCTCTAGACAGTCGATGG + Intronic
1041269754 8:56099815-56099837 TTTTGACTTTAGAAAGTGGCTGG + Intergenic
1043340806 8:79236332-79236354 TTTTATTTGTATAAAGTTAAGGG - Intergenic
1044264987 8:90171403-90171425 TTTTATCTTGAAAAAATGGAAGG - Intergenic
1046517414 8:115281310-115281332 TTTTTTTTGTAGAAACTGTAGGG - Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046900148 8:119515144-119515166 TTCTCTCTATAGAAAGTGAAAGG - Intergenic
1047621196 8:126609852-126609874 TTTTATCTGTAAAAATGAGAAGG - Intergenic
1048739034 8:137533652-137533674 TTTTATGTATAGAAAGTGTTTGG + Intergenic
1050033754 9:1413669-1413691 TTTTCTCTATAGTAAGTGTAGGG + Intergenic
1050088746 9:1994171-1994193 TTTAATCTGTAAAACGTGAAAGG - Intergenic
1050989149 9:12125082-12125104 TTTTATCTTAAGCAAATGGATGG + Intergenic
1051959465 9:22740542-22740564 TTTTATTTGAAGCAAGTGGTAGG + Intergenic
1052272825 9:26644354-26644376 TTTTATCTATAGAAAGTTCAGGG + Intergenic
1052477763 9:28982326-28982348 TTTTGGCGGTAGAAAATGGAGGG + Intergenic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1056923949 9:90816575-90816597 TTATATCTGTACAAGGTGGAAGG + Intronic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1058689654 9:107508702-107508724 CTTTATTTGTAGCAAGAGGAGGG + Intergenic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059906157 9:118989199-118989221 TTTTGACCTTAGAAAGTGGAGGG + Intergenic
1060370693 9:123067877-123067899 TTCTATAGGTAGAAAATGGAGGG - Intronic
1062061412 9:134497518-134497540 TTTCATCTGAATAAAGTGGCAGG - Intergenic
1062144175 9:134979659-134979681 TTTTCTCTGTGGAAACAGGAAGG + Intergenic
1203541370 Un_KI270743v1:91158-91180 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1185833878 X:3327542-3327564 TCTTATGTGTAGAAAGAGGCAGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1186695814 X:12030737-12030759 CTTTATCTCTAGTAAGTAGATGG - Intergenic
1187397359 X:18930372-18930394 TGTCATTTGTAGAAAGTGCAAGG - Intronic
1187478148 X:19629917-19629939 ATTTATCTGTACCATGTGGATGG + Intronic
1188260822 X:28021559-28021581 TTTTATTTGTATAAATTTGAAGG + Intergenic
1191190904 X:57666180-57666202 TTTTATAGGTAGAAAATGGGAGG - Intergenic
1192420519 X:71025882-71025904 TTTTTTTTGTAGAAATGGGAAGG - Intergenic
1193195022 X:78621133-78621155 TTTTATTTGTATAAATTTGAGGG - Intergenic
1193504917 X:82330376-82330398 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
1193841743 X:86415721-86415743 TTTTATCTGGAGAAAATACATGG + Intronic
1194586159 X:95736613-95736635 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1195584117 X:106543949-106543971 TTTTATTTGTAAAAATTGAAGGG + Intergenic
1196552568 X:117046078-117046100 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1198841083 X:140858868-140858890 TTTTGCCTGTGGAAAGGGGAAGG + Intergenic
1201622266 Y:15973227-15973249 TTTTATCTGTAAAAATTTTAAGG - Intergenic