ID: 1170993555

View in Genome Browser
Species Human (GRCh38)
Location 20:21328872-21328894
Sequence AAGAGGGAGCCTTGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170993548_1170993555 19 Left 1170993548 20:21328830-21328852 CCAATAGGCTTAATAGGCTTGTT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1170993555 20:21328872-21328894 AAGAGGGAGCCTTGGGAATAGGG 0: 1
1: 0
2: 1
3: 19
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170993555 Original CRISPR AAGAGGGAGCCTTGGGAATA GGG Intronic
900885498 1:5412527-5412549 TACAGGGAGCCTTGGGAAGAAGG - Intergenic
902448906 1:16484555-16484577 AAGAGGGAGCATTTGGGATGAGG - Intergenic
902505859 1:16938795-16938817 AAGAGGCAGCATTTGGAATGAGG + Intronic
902817241 1:18923267-18923289 CAGAGGGGCCCTTGGGAATGAGG + Intronic
903874264 1:26461910-26461932 TAGAGGGAGCTTTGGTCATATGG - Intronic
904445748 1:30571853-30571875 ATGAGGGAGCCTGGAGAAGATGG - Intergenic
905775418 1:40664874-40664896 AAGAGGGGGCTTTGGGAAGCTGG - Intronic
906822319 1:48942572-48942594 AAGTGGAAGACTTAGGAATATGG - Intronic
908168050 1:61477514-61477536 TAGAGGGAGTCTTGAGGATAAGG - Intergenic
910093029 1:83487991-83488013 CAGAGAGTGCCTTGGGATTAAGG + Intergenic
910439982 1:87242043-87242065 AAGAGTGAACCTTGAGAACAAGG + Intergenic
912643363 1:111368761-111368783 ATGGGGGTGCCTTGGGAATGGGG - Intergenic
914427121 1:147587525-147587547 AGGAGCCAGACTTGGGAATAGGG - Intronic
914441607 1:147712455-147712477 ACGAGGGGCCCTTGGGAACAGGG - Intergenic
915664276 1:157430567-157430589 AAGAGGGTGCCTTGGGGTTTTGG + Intergenic
915956719 1:160226348-160226370 GAGAGGGAGTCTTGAGGATATGG - Intronic
916071961 1:161175738-161175760 GACAGGGAGGCTTGGGGATAGGG - Intronic
918325459 1:183405557-183405579 ACATGGGAGCCCTGGGAATAGGG + Intronic
918712829 1:187752117-187752139 AAGAGGTAGCATTGGAAATGAGG + Intergenic
920662760 1:207931544-207931566 AATAGGGAGGCTTGGGGAGAGGG + Intergenic
922089330 1:222380499-222380521 AACAGGGAGAATTGGTAATATGG - Intergenic
922510324 1:226160741-226160763 AAGAGGGAGCTGTGGGTACAAGG - Intronic
922865867 1:228861109-228861131 AACAGGGGCCCCTGGGAATAGGG + Intergenic
923340126 1:232999917-232999939 AAGAGGAGCCATTGGGAATAAGG + Intronic
923865761 1:237937946-237937968 TAGAGGGACCCTTGAGACTATGG + Intergenic
924157944 1:241200668-241200690 GAGAGGGAGCTTTAGGAAGACGG - Intronic
924636566 1:245793459-245793481 AAGCCGGAGCCTTGGCAGTAGGG - Intronic
924778598 1:247128008-247128030 AAGAGTTAGGCTGGGGAATACGG - Intronic
1063161904 10:3424418-3424440 TAGAGTGAGCCTTGGGGAGAAGG + Intergenic
1063493462 10:6486217-6486239 AAGACAGAGCCTTGCGGATAGGG + Intronic
1063569554 10:7202253-7202275 AAAAGTGAGCCATGGGAATCTGG + Intronic
1064854366 10:19748768-19748790 GAAAGGGAGAATTGGGAATAAGG - Intronic
1066103741 10:32139391-32139413 AACAGGTTGCCTTGGGAATCTGG - Intergenic
1067155249 10:43776120-43776142 AAGAGGGAGCCTGGGAAACCTGG - Intergenic
1067234336 10:44435689-44435711 AGGAGGGAGCCTGGGGACGAGGG - Intergenic
1067497353 10:46773162-46773184 AAGAGGGCGCCCTGGGAAAGGGG + Intergenic
1067509863 10:46885648-46885670 ATGAGGAAGCCTTGGGGAAATGG + Intergenic
1067597299 10:47567253-47567275 AAGAGGGCGCCCTGGGAAAGGGG - Intergenic
1067652391 10:48166210-48166232 ATGAGGAAGCCTTGGGGAAATGG - Intronic
1068483759 10:57629622-57629644 AAGAGTAAGACTTGGTAATAAGG + Intergenic
1069602325 10:69716073-69716095 AAGAGGCAGCCTGGGGGAGAAGG - Intergenic
1069798278 10:71067017-71067039 CAAAGGGAGCCTTTGGAACAGGG + Intergenic
1070287259 10:75093021-75093043 AAGAGGGATCCAAGGGAATTGGG + Intergenic
1072328340 10:94320700-94320722 AAGAGGGAGACTTAGTAAAAGGG - Intronic
1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG + Intergenic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1075453131 10:122567348-122567370 AAGAGGGGCCCTTCCGAATAAGG + Intronic
1075490738 10:122866769-122866791 AATAGGGAGGCCTGAGAATAGGG - Intronic
1075679896 10:124324373-124324395 AAGAGGGAGGCTTTGAAAGAGGG - Intergenic
1075981179 10:126741197-126741219 AAAAGGGAGCCATGGGGATGAGG + Intergenic
1076697941 10:132256095-132256117 AAGATGGAGCCTGGGGCACAGGG - Intronic
1080394077 11:31873985-31874007 CAGATGGAGCCTAGGGGATAAGG + Intronic
1080862041 11:36158382-36158404 AAGGTGGACCCTTGGGTATATGG - Intronic
1081660738 11:44886659-44886681 AAGGAGGAGACGTGGGAATAAGG + Intronic
1081842579 11:46213704-46213726 AAGAGGGGGCCTGGGGAACCAGG - Intergenic
1084119914 11:67062910-67062932 AAGAGGGAGCTTTTGTAAGATGG - Intronic
1086878619 11:92128230-92128252 CAGAGGGAGACTTGGGGTTATGG - Intergenic
1086903431 11:92392919-92392941 GACAGGGAGCTTTGGGAATCTGG + Intronic
1087477666 11:98657016-98657038 ATGAGGGAGCTTTGGGATGATGG + Intergenic
1087692563 11:101338631-101338653 AAGAAGGAGCCTGGGAAGTAAGG + Intergenic
1088459655 11:110069206-110069228 AATTAGGACCCTTGGGAATAAGG - Intergenic
1089079686 11:115765328-115765350 ATGAGGGAGTCTTTGGCATATGG - Intergenic
1089876723 11:121729186-121729208 ATGAGAGAGCCTTGGGATGATGG - Intergenic
1090532961 11:127610120-127610142 AAGAGGGAGTCCTGGGAGAAGGG + Intergenic
1090718444 11:129451422-129451444 AAGAGGGAGACTGGGGAGAAGGG + Exonic
1091745163 12:2987309-2987331 AATATGGAGCCCAGGGAATATGG + Intronic
1092058076 12:5523547-5523569 TAGAGGGAGGCTTGAGAACACGG + Intergenic
1093589237 12:20880772-20880794 AAGAGGGAGACAAGGGGATAAGG - Intronic
1093903610 12:24663474-24663496 AAGAAGCAGCCTGGGAAATATGG + Intergenic
1094064749 12:26350735-26350757 AAGAGGGAGAGTTGGGAAGGAGG - Intronic
1096446702 12:51699501-51699523 AAGAGGGAGGCTTGGGGAGGTGG + Intronic
1096543938 12:52324126-52324148 AAGAGGCAGCCTGGGGATTTGGG - Intergenic
1096594789 12:52688009-52688031 TGGAGGCAGCCTTGGGAATCAGG - Intergenic
1096729500 12:53596555-53596577 GAGAGGGAGGCATAGGAATATGG + Intronic
1097077647 12:56407324-56407346 GAAAGGGAGTCTCGGGAATAGGG + Intergenic
1097443046 12:59634500-59634522 AAGAGGAAACTTTGGGGATAAGG + Intronic
1097952913 12:65452665-65452687 ATGAGGGAGCTTTGGGGATTTGG + Intronic
1099673115 12:85719500-85719522 AAGAGAGAGAGATGGGAATAGGG + Intergenic
1100198792 12:92276843-92276865 AAAAGGAAGCCCTGGGAATCTGG + Intergenic
1103027890 12:117588344-117588366 AAAAGGTAGCCATGGGAAGAAGG + Intronic
1103039706 12:117685081-117685103 AAGAGGGAGCCATGGGCTTCTGG - Intronic
1104111901 12:125711998-125712020 AGGAGAGAGCCTTGTGAAGACGG + Intergenic
1106587954 13:31073375-31073397 CAAAGGGAGCCATGGGAATGGGG - Intergenic
1106875533 13:34068039-34068061 CAGAGGAAGCCATAGGAATATGG + Intergenic
1107216937 13:37932984-37933006 AAGAGTGAGTTTTGGGAGTAAGG - Intergenic
1107256010 13:38427534-38427556 GAGATGGAGTCTTGGGAACATGG - Intergenic
1107485379 13:40821675-40821697 AAGAGTGTGCGTTGGGAATTGGG + Intergenic
1109764323 13:66873688-66873710 AAGAGGAAGGCTTGGGAAGCTGG - Intronic
1111468162 13:88644444-88644466 AAAAGGGAGTCTTGGGAATTGGG - Intergenic
1112709474 13:102111033-102111055 AAGAGGCAGTCTTGGGCAGAGGG - Intronic
1114560904 14:23589703-23589725 AACAGGGGGCCTTGGGAGTCAGG + Intergenic
1114765287 14:25363910-25363932 ATGAGGTAGACTTGGGAAGATGG + Intergenic
1115495753 14:34002932-34002954 AAGAGGGAGCTTTAGGATGATGG + Intronic
1115640512 14:35332810-35332832 AAGAGGGAACCCAGGGAAGAAGG + Intergenic
1115862995 14:37710720-37710742 AAGAGTGAGCCTTTGGAATGAGG - Intronic
1117834344 14:59786633-59786655 AAGAGGGAGGATGGGGAAGAAGG + Intronic
1117921001 14:60724728-60724750 AAGAGGGAGAATGGGGAACAGGG - Intergenic
1118687244 14:68303069-68303091 AATAGGGAGCCATTGAAATAGGG + Intronic
1118764314 14:68899792-68899814 AGGAAGGAGCTTTGGGAAGAGGG + Intronic
1118785549 14:69042840-69042862 AAGAGGCACCCTTGGGTGTAGGG - Intergenic
1118975606 14:70673585-70673607 AAGTTGGAGGCTTGGGAATGGGG - Exonic
1119222678 14:72922164-72922186 AAGAGGGAGCCGTGGGTAATGGG - Intergenic
1119675019 14:76547105-76547127 AAGAGGCAGCCTTTGGAACCTGG - Intergenic
1119968440 14:78942966-78942988 GAGAGGGAGGGTTGGGAAAATGG + Intronic
1121049819 14:90812976-90812998 AAGTGGGAGCTTTGGGAAGGAGG + Intronic
1122091349 14:99343007-99343029 AAGAGCCAGGCTTGTGAATAAGG + Intergenic
1122898260 14:104771222-104771244 AAGAGGGAGACTGTGGAACAAGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1125574776 15:40747726-40747748 CAGAGGGAGCCTTGGGTCTCTGG - Intronic
1125584912 15:40813311-40813333 AAGAGGGAGACATGGGAACAGGG - Intronic
1125965164 15:43869018-43869040 AACAGGGAGCCTTAGGGCTATGG + Intergenic
1126172507 15:45706074-45706096 GATGGGCAGCCTTGGGAATATGG + Intergenic
1127224669 15:56917558-56917580 AAGAAGGAGCCTTTGGATTCCGG - Intronic
1128084960 15:64879509-64879531 AAGACCGAGTATTGGGAATAAGG + Intronic
1128126963 15:65200290-65200312 AAGAGGGAGCCTTGGTGTGATGG + Intronic
1130130604 15:81138588-81138610 ATCAGGGAGCCTTGGGGATTAGG + Intronic
1130699032 15:86160647-86160669 TAGAAGAAGCCTTGTGAATAGGG - Intronic
1131612846 15:93983183-93983205 GAGAGGGAGACCTGGGATTAGGG + Intergenic
1131697464 15:94893650-94893672 AAGAGGGAGACTGGGGAGTTTGG + Intergenic
1132202000 15:99961386-99961408 AAGGGGGAGCATTTGGAAAATGG + Intergenic
1133481821 16:6178157-6178179 AAGAGTGACCTTTGGAAATATGG - Intronic
1134072777 16:11271193-11271215 AAGAGGAAACCATGGGAAGATGG + Intronic
1136175764 16:28515166-28515188 AACATGGAGCCATGGGAATTAGG - Intergenic
1138661216 16:58518476-58518498 AAGAGGGAGCCTTTGTGATAGGG + Exonic
1138836544 16:60443327-60443349 AAGAGGGGGGCTTATGAATAAGG - Intergenic
1141806670 16:86346271-86346293 ATGAGTGAGCCTTGAGGATATGG - Intergenic
1142049576 16:87949647-87949669 AAGGAGGAGCCTTGGCAAAATGG - Intronic
1142349548 16:89573867-89573889 GAGGGGGAGCCTTGGAAAGATGG + Intergenic
1143057921 17:4176184-4176206 AAGAAGGCGCCTTGGGAGTGAGG - Intronic
1144327805 17:14198357-14198379 AAGAGGGGGCCTTGGCAAGAAGG - Intronic
1144564363 17:16347747-16347769 AAGAGGGAGACTGGGGCATGGGG + Intronic
1144728090 17:17511765-17511787 AAGAGGGGGCCTTCGGAACCTGG - Intronic
1144948173 17:18980421-18980443 AAGAGGGCTCCTTGGGCATGAGG + Intronic
1148715160 17:49710798-49710820 GAGAGGGAGGCATGGGAATAGGG + Exonic
1151478928 17:74358843-74358865 ATGAGGGAGCCTGGGAAATGTGG - Intronic
1151922079 17:77164470-77164492 AAGGGGGAGCGCTGGGAAAAAGG - Intronic
1156796155 18:41048740-41048762 AAGAAGGAGCCATCGGAATTTGG + Intergenic
1157176332 18:45455964-45455986 AAGAGGAAGTCTTGTGAATGAGG + Intronic
1158712239 18:59847975-59847997 AAGATGGAGCCTTGACACTAGGG + Intergenic
1158813658 18:61068338-61068360 AAGGGGGAGCCCAGGGAAGAAGG - Intergenic
1159301301 18:66573094-66573116 AAGAGAGAGCCTTGGGTCAATGG - Intronic
1160345540 18:78129059-78129081 AGGAAGGAGCCTTGTGAAGAGGG + Intergenic
1160592975 18:79954191-79954213 AAGAGAGGGCCATGGGAAGATGG + Intergenic
1160751462 19:736364-736386 AGGAGGGAGCCGTGAGATTAGGG - Intronic
1161812933 19:6481169-6481191 AAGAGGCAGCCTTGGGCTCAAGG + Intronic
1161995090 19:7707122-7707144 AAGAGGGGGCCTTAGGACTATGG - Intergenic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1162957199 19:14105986-14106008 GAGAGGGAGCTTTGGGAAGGCGG + Intronic
1163089114 19:15006417-15006439 GCGATGGAGGCTTGGGAATATGG - Intronic
1163171990 19:15537685-15537707 AAGAGGGTGTCTTGGGAGTGAGG + Intronic
1163713863 19:18863002-18863024 AAGAGGGCGCCTTAGAAAGAGGG - Intronic
1163716521 19:18875795-18875817 AAGAGAAAGCCCTGGGAAGACGG + Intronic
1164213511 19:23121729-23121751 AAGCTGTAGCCTTGGGCATACGG - Intronic
1164396940 19:27874161-27874183 AAGAAGCAGCCTTGGGAAGCAGG - Intergenic
1164673143 19:30084543-30084565 CAGAGGGAGCCCAGGGAATGTGG - Intergenic
1165066203 19:33230109-33230131 ATTAGGCAGCCTTGGGAAGAGGG - Intergenic
927480667 2:23451537-23451559 ATGAGGCTGCCTTGGGAAGAGGG - Intronic
927553105 2:24016057-24016079 AAGAGGGAGGCCTGGGAACCGGG - Intronic
928549328 2:32356560-32356582 AACAGAAAGCCTTGGGAATGGGG + Intergenic
929671066 2:43876702-43876724 ATAAAGGAGCCGTGGGAATATGG + Intronic
930614405 2:53578605-53578627 AAGAAGGTGGCTTGGGAATGGGG + Intronic
931927554 2:67090225-67090247 ATAAGAAAGCCTTGGGAATATGG - Intergenic
934551327 2:95264316-95264338 AAGAGGGATACCTGGGGATAGGG - Intergenic
935247100 2:101228238-101228260 ATGAGGGAGCCTTGGGGTGAGGG - Intronic
937863521 2:126731522-126731544 AACAGGGATCCTTGGGTACAGGG + Intergenic
938061846 2:128261133-128261155 AAGAGGAAGCCTGGGGACTTTGG - Intronic
939896827 2:147801586-147801608 AAGATGCACACTTGGGAATACGG - Intergenic
940178488 2:150905295-150905317 AAGAGGAAGAGTTGGGAATAAGG + Intergenic
940201134 2:151152285-151152307 AAGAGGCAGAATTGGGAATTAGG + Intergenic
941590793 2:167417670-167417692 AAGAGGTGGCTTTAGGAATAAGG + Intergenic
942822191 2:180127189-180127211 AATTGGGAGCTTTGGGAAAAGGG + Intergenic
943050756 2:182910455-182910477 CAGTTGGAGCCTTGGGAACAAGG + Intronic
943441686 2:187933946-187933968 AAGAGGGAGTCTCAGGAATTGGG + Intergenic
943847956 2:192675774-192675796 ATCAGAGATCCTTGGGAATATGG - Intergenic
947655333 2:231821831-231821853 AAGAGGGAGCCTTGTGATGATGG - Intergenic
947823562 2:233089161-233089183 AAGAGAGAGCCTTGAGGACACGG + Intronic
948007656 2:234623658-234623680 AAGAGGGAGCCTAGGAAGTCCGG + Intergenic
1169907364 20:10617341-10617363 CAGAGGGAGCCTTTTGAAAATGG - Intronic
1169953096 20:11069931-11069953 AAGAGGGAGCTCTGAGAAGACGG - Intergenic
1170993555 20:21328872-21328894 AAGAGGGAGCCTTGGGAATAGGG + Intronic
1172842152 20:37908394-37908416 AAGAGAGAGGCTTGGGACGATGG - Intronic
1174254730 20:49246142-49246164 AAGAGGGAGTGTTGGGATGAAGG + Exonic
1175415328 20:58797107-58797129 AGCAGGGAGCCTCGGGAATGAGG - Intergenic
1175908472 20:62393305-62393327 CAGATGGAGCCTGGGGAACAGGG - Intronic
1180158723 21:45989757-45989779 AAAAGGGAGCCGTGGGGAGAAGG + Exonic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
951034793 3:17921227-17921249 AAGAGGGAGCCATGGGAAGATGG + Intronic
952278514 3:31901397-31901419 AAGTGGGGGCATTGGGAAGATGG - Intronic
952493023 3:33889802-33889824 ACAAGGGAGCCTTGGAAATAAGG + Intergenic
953760405 3:45682454-45682476 AAGAGTCAGCCTTGGGCATTGGG + Exonic
954183006 3:48896368-48896390 AAAAGGCAGCCTTGGCAACATGG - Intronic
956533851 3:70253256-70253278 TAGAGGGAGCCATGTGGATAGGG + Intergenic
957425565 3:80034931-80034953 AAAAGGAAGCCTTGTGAAGAAGG - Intergenic
958518176 3:95148454-95148476 AAAAGGCAGCCTTGTGAAGATGG + Intergenic
958729888 3:97950250-97950272 AATAGAGATCCTTGGAAATATGG + Intronic
959240303 3:103783670-103783692 AAGAGGGATCCTAGAGAACATGG - Intergenic
959883441 3:111473180-111473202 AGGAGGGACCCTAGTGAATAGGG - Intronic
961521256 3:127468578-127468600 AAGAGGTAGCCACAGGAATATGG + Intergenic
961806098 3:129490431-129490453 CAGAGGGAAGCCTGGGAATAGGG - Intronic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
962812544 3:138972036-138972058 AGCAGGGAGCCATGGGAACAGGG + Intergenic
963593807 3:147299517-147299539 AACAATGAGCTTTGGGAATATGG + Intergenic
964568398 3:158084630-158084652 AATAGGCAGTATTGGGAATACGG + Intergenic
964893351 3:161563260-161563282 TAGACAGAGCCTTGGTAATAGGG + Intergenic
965520980 3:169668084-169668106 AAAAGGGAGCCTTAGGCAAAAGG + Intergenic
966200640 3:177357365-177357387 AACAGGGTGCCTTAGGAACAGGG + Intergenic
966420736 3:179732019-179732041 TAGAGGCAGCCTTGGGGATGGGG + Intronic
967088981 3:186119124-186119146 AAATGGGAGACTTGGGAATTTGG - Intronic
967216998 3:187219356-187219378 AGGAGGGAGCCTGGGGATTGTGG - Intronic
967484506 3:190014844-190014866 AGGAGGGAGCCTTGGTAAGAGGG + Intronic
967869245 3:194216323-194216345 AAGAGGCAGCATTGGGAGAAAGG - Intergenic
969877385 4:10145807-10145829 AAGAGGAACCCATGGGAATGGGG - Intergenic
970769064 4:19588306-19588328 ATCAGGGAGCCTTAGGAAGATGG - Intergenic
970835513 4:20400773-20400795 AAGAGGAATCCATGGGAATGTGG + Intronic
971092633 4:23362498-23362520 GAGAGGAAGCCTTGAGAACATGG + Intergenic
971379581 4:26084683-26084705 AAGAGGGGGCCGTGCGAAGATGG - Intergenic
971947906 4:33305622-33305644 AATAGGGAGACGTGGGGATAGGG + Intergenic
972388759 4:38592830-38592852 ACATGGGAGCCTGGGGAATATGG - Intergenic
972689490 4:41382669-41382691 AAGAGGGAGCCTTTGAGACAGGG - Intronic
974144581 4:57931123-57931145 AACAGGGAACTTAGGGAATAAGG - Intergenic
975659655 4:76675771-76675793 CAGAGGGATCCTTGGGCTTAAGG - Intronic
977710121 4:100115071-100115093 AAGAGGAAGCATTAGGAGTAAGG - Intergenic
980576829 4:134693894-134693916 AAGAGGGGGCCTTGGAGGTATGG - Intergenic
981271933 4:142855448-142855470 ATGTAGGAGCCTTGGGAATAGGG - Intergenic
982357656 4:154488570-154488592 ATGAGGCAACCTAGGGAATAAGG - Intronic
982660508 4:158201147-158201169 AAGAGTGAGGATTGGGAAGAAGG - Intergenic
988692537 5:33587134-33587156 AAAAGGGAGTCTTGGAAATAAGG + Intronic
990536967 5:56732669-56732691 AAGAGGGAGGCTGGGGAAGGAGG + Intergenic
991588668 5:68225802-68225824 AAGAGGGAGCAGTGGGATTGGGG - Intronic
995621269 5:114028676-114028698 AACAGGGAGCCTTGGGACGCTGG - Intergenic
996666397 5:126065100-126065122 AAGAGGAAGACTTTGGAAAATGG + Intergenic
997677788 5:135726415-135726437 ATGAGGGATCCTTGTGATTATGG - Intergenic
998173952 5:139889098-139889120 AAGAGGGTTCCATGGGAAAATGG + Intronic
1000180221 5:158802038-158802060 TATGGGTAGCCTTGGGAATAAGG + Intronic
1000291901 5:159878413-159878435 AGGAGGGAGGCTGGGAAATAAGG + Intergenic
1000606831 5:163335674-163335696 AAGAAGGAGCCTGGGGAGGATGG - Intergenic
1001375736 5:171255985-171256007 AACCAGGAGGCTTGGGAATAGGG + Intronic
1003970836 6:11297559-11297581 GAGAATGAGCCTTGGGAATCTGG - Intronic
1005017117 6:21385005-21385027 AAAAGGGAGCTTTGGAGATAAGG + Intergenic
1005906261 6:30263459-30263481 AAGAAAGAGCCCTGGAAATAGGG - Intergenic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1007240751 6:40423319-40423341 AAGAGGCAGGCTGGGGAATAGGG + Intronic
1007813702 6:44505041-44505063 AAGAGGTGGCCTTGGGTAGAAGG - Intergenic
1008071858 6:47106320-47106342 GAGAAGGAGGCTTGAGAATAAGG - Intergenic
1008645921 6:53514739-53514761 TACAGGGAGCCTTGGGAGCAGGG - Intronic
1010518606 6:76804919-76804941 AAGAGGGAGACGTGGGATTCAGG - Intergenic
1012760264 6:103292675-103292697 AAGAGGGACCCAGGGGAATCTGG + Intergenic
1016120894 6:140340066-140340088 AAGTGGGAGTCCTGGGAATTGGG + Intergenic
1018899828 6:168045482-168045504 AAGAGGGAGCCTGGGGGGAAAGG - Intergenic
1019168391 6:170114730-170114752 AAGAGGGAACCTTGGGGAGATGG - Intergenic
1019999690 7:4748614-4748636 AAGAGGAAGACGTGGGAATCAGG - Intronic
1020878274 7:13726201-13726223 AAGGGGAAGCTTTGGGAACAAGG + Intergenic
1023368336 7:39487519-39487541 AAGAGGAAGCCTTTGGGACAAGG - Intronic
1027309889 7:76944486-76944508 CAGAGAGTGCCTTGGGATTAAGG + Intergenic
1028538173 7:91912521-91912543 AAGAATGAACCTTGGAAATATGG + Intergenic
1029935139 7:104416558-104416580 ACAAGGGAGGCTTGGGAAAAGGG + Intronic
1034389313 7:150771838-150771860 GAGACGGAGTCTTTGGAATAGGG - Intergenic
1035440662 7:158895410-158895432 AAAAGGGAGCAATGGCAATACGG - Intronic
1038923230 8:32109255-32109277 AACAGCGAACCTTGGGAAAAAGG - Intronic
1039366347 8:36932161-36932183 AAGAGGGAGCTTCTGGAATGTGG - Intronic
1039818743 8:41117895-41117917 AAGAGGGAGCACTGGCAAGAGGG + Intergenic
1041568989 8:59314412-59314434 GAGAGGAAGCCTGGGGAAGAGGG - Intergenic
1042715032 8:71763266-71763288 AAGAGCTAGTCTTTGGAATAGGG + Intergenic
1044300203 8:90574724-90574746 AAGAGGGTGTGTAGGGAATAGGG - Intergenic
1047039799 8:120980289-120980311 AAAAGGTAGCCTTGTGCATATGG + Intergenic
1047254693 8:123206640-123206662 AGGAGGGAGCCTTGAGACCAGGG + Intronic
1048527163 8:135213679-135213701 ATGAGGGAGCTTAGGGAATGAGG + Intergenic
1048782687 8:138019108-138019130 AATAGGGAGCCTTGGTATTTTGG + Intergenic
1049087998 8:140493047-140493069 AAGAGAAAGCATTGGGAGTAAGG - Intergenic
1050058697 9:1681976-1681998 AATAGGGAGCATTCGAAATAGGG + Intergenic
1050934090 9:11371789-11371811 TAAAGGGAGCCTTGGGAATCAGG - Intergenic
1051211210 9:14746593-14746615 AAGATGGAGAATTGGGATTAGGG - Intronic
1052271845 9:26635554-26635576 AAGAAGGAGCCTTGGGGAAAAGG + Intergenic
1052445944 9:28561196-28561218 TAAAGGGAGCCTGGGAAATAAGG - Intronic
1052616533 9:30849359-30849381 CAGAGGGAGGCTTAGGAAAATGG + Intergenic
1052766586 9:32647694-32647716 AGGAGGGAGCCCTGTGAAGACGG - Intergenic
1052913432 9:33904988-33905010 ATGTGGGAGCTTTGGGGATAGGG + Intronic
1053473935 9:38368108-38368130 AAGAGGGGGCATTTTGAATAGGG - Intergenic
1055944456 9:81680387-81680409 AACAGGGGGAGTTGGGAATAGGG - Intronic
1057955337 9:99402986-99403008 AAGGGGGAGTCTGGGGAATGGGG + Intergenic
1058632144 9:107000217-107000239 AAGGGGGAGCCTAGAGAAGATGG + Intronic
1060462248 9:123867823-123867845 TAGAGTCAGCCTTGGGACTATGG + Intronic
1060688631 9:125636104-125636126 TGGAGGAAGACTTGGGAATAGGG - Intronic
1061456036 9:130698434-130698456 AAGAGGGAGCAGTTGGCATATGG + Intronic
1062363118 9:136196876-136196898 AAGAGGGAGCCTCGGGGTGACGG + Exonic
1186977976 X:14928634-14928656 AAGAGGGAGCAAGGGGAATGAGG - Intergenic
1188135421 X:26488663-26488685 AAAAGGGAGCTTTGGGAAATGGG - Intergenic
1189890535 X:45597512-45597534 AAGAGGTAACCTTGGTAATATGG + Intergenic
1190476246 X:50830698-50830720 AAGAAGTAGCATTGGCAATAAGG - Intergenic
1191677842 X:63810471-63810493 AAGACGTAGGATTGGGAATACGG - Intergenic
1195108943 X:101625835-101625857 AAGAGGGAGCCCAGTGAAGATGG - Exonic
1195684677 X:107574877-107574899 AAGAGGGAGCCATGGGGCTGTGG - Intronic
1196649362 X:118153121-118153143 AACAGGGAGCCCTGGGAGCAGGG - Intergenic
1198287047 X:135201125-135201147 AACAGGGATCCTTGTAAATAGGG + Intergenic
1200012293 X:153127870-153127892 AAGGAGGAGTCTTGGGAAGAGGG - Intergenic
1200027307 X:153272049-153272071 AAGGAGGAGTCTTGGGAAGAGGG + Intergenic
1201389114 Y:13478515-13478537 AAGGGGGAAGCTTGGGAAGAGGG - Intronic