ID: 1170998562

View in Genome Browser
Species Human (GRCh38)
Location 20:21391247-21391269
Sequence GGAAACAGCCTGACTACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170998558_1170998562 2 Left 1170998558 20:21391222-21391244 CCTGTTAAACAAAATCTTAGAAC No data
Right 1170998562 20:21391247-21391269 GGAAACAGCCTGACTACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170998562 Original CRISPR GGAAACAGCCTGACTACTCT GGG Intergenic
No off target data available for this crispr