ID: 1171005426

View in Genome Browser
Species Human (GRCh38)
Location 20:21460885-21460907
Sequence CTGAAAATACAAAAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171005421_1171005426 2 Left 1171005421 20:21460860-21460882 CCAAACCGGTGAAACCCTGTCTC No data
Right 1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG No data
1171005422_1171005426 -3 Left 1171005422 20:21460865-21460887 CCGGTGAAACCCTGTCTCTACTG No data
Right 1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG No data
1171005420_1171005426 7 Left 1171005420 20:21460855-21460877 CCTAACCAAACCGGTGAAACCCT No data
Right 1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171005426 Original CRISPR CTGAAAATACAAAAGTAGCT GGG Intergenic
No off target data available for this crispr