ID: 1171009120

View in Genome Browser
Species Human (GRCh38)
Location 20:21498357-21498379
Sequence GCTGAAACAATGACCGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171009120_1171009121 -9 Left 1171009120 20:21498357-21498379 CCAGCTTCGGTCATTGTTTCAGC No data
Right 1171009121 20:21498371-21498393 TGTTTCAGCAGCCCCTGCACAGG No data
1171009120_1171009125 8 Left 1171009120 20:21498357-21498379 CCAGCTTCGGTCATTGTTTCAGC No data
Right 1171009125 20:21498388-21498410 CACAGGCAGCCTCTCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171009120 Original CRISPR GCTGAAACAATGACCGAAGC TGG (reversed) Intergenic
No off target data available for this crispr