ID: 1171010691

View in Genome Browser
Species Human (GRCh38)
Location 20:21507892-21507914
Sequence GAAAGGTTCTGAGAGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171010691_1171010697 -6 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010697 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
1171010691_1171010701 11 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010701 20:21507926-21507948 GGAAGGGCGGCTCCGCGCGCGGG No data
1171010691_1171010702 19 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010702 20:21507934-21507956 GGCTCCGCGCGCGGGCGCTTCGG No data
1171010691_1171010703 20 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010703 20:21507935-21507957 GCTCCGCGCGCGGGCGCTTCGGG No data
1171010691_1171010695 -10 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010695 20:21507905-21507927 AGAACCTTTCTCGCGGTGAGTGG No data
1171010691_1171010706 25 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data
1171010691_1171010698 -5 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010698 20:21507910-21507932 CTTTCTCGCGGTGAGTGGAAGGG No data
1171010691_1171010704 21 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010704 20:21507936-21507958 CTCCGCGCGCGGGCGCTTCGGGG No data
1171010691_1171010707 29 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010707 20:21507944-21507966 GCGGGCGCTTCGGGGCCGGTCGG No data
1171010691_1171010700 10 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010700 20:21507925-21507947 TGGAAGGGCGGCTCCGCGCGCGG No data
1171010691_1171010699 -2 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171010691 Original CRISPR GAAAGGTTCTGAGAGGCCAA GGG (reversed) Intergenic