ID: 1171010694

View in Genome Browser
Species Human (GRCh38)
Location 20:21507899-21507921
Sequence ACCGCGAGAAAGGTTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171010694_1171010706 18 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data
1171010694_1171010707 22 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010707 20:21507944-21507966 GCGGGCGCTTCGGGGCCGGTCGG No data
1171010694_1171010699 -9 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data
1171010694_1171010703 13 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010703 20:21507935-21507957 GCTCCGCGCGCGGGCGCTTCGGG No data
1171010694_1171010701 4 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010701 20:21507926-21507948 GGAAGGGCGGCTCCGCGCGCGGG No data
1171010694_1171010704 14 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010704 20:21507936-21507958 CTCCGCGCGCGGGCGCTTCGGGG No data
1171010694_1171010700 3 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010700 20:21507925-21507947 TGGAAGGGCGGCTCCGCGCGCGG No data
1171010694_1171010702 12 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010702 20:21507934-21507956 GGCTCCGCGCGCGGGCGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171010694 Original CRISPR ACCGCGAGAAAGGTTCTGAG AGG (reversed) Intergenic