ID: 1171010696

View in Genome Browser
Species Human (GRCh38)
Location 20:21507909-21507931
Sequence CCTTCCACTCACCGCGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171010696_1171010711 27 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010711 20:21507959-21507981 CCGGTCGGTTGCGAAATCAGGGG No data
1171010696_1171010706 8 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data
1171010696_1171010701 -6 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010701 20:21507926-21507948 GGAAGGGCGGCTCCGCGCGCGGG No data
1171010696_1171010709 26 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010709 20:21507958-21507980 GCCGGTCGGTTGCGAAATCAGGG No data
1171010696_1171010707 12 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010707 20:21507944-21507966 GCGGGCGCTTCGGGGCCGGTCGG No data
1171010696_1171010702 2 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010702 20:21507934-21507956 GGCTCCGCGCGCGGGCGCTTCGG No data
1171010696_1171010704 4 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010704 20:21507936-21507958 CTCCGCGCGCGGGCGCTTCGGGG No data
1171010696_1171010703 3 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010703 20:21507935-21507957 GCTCCGCGCGCGGGCGCTTCGGG No data
1171010696_1171010700 -7 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010700 20:21507925-21507947 TGGAAGGGCGGCTCCGCGCGCGG No data
1171010696_1171010708 25 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010708 20:21507957-21507979 GGCCGGTCGGTTGCGAAATCAGG No data
1171010696_1171010712 28 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010712 20:21507960-21507982 CGGTCGGTTGCGAAATCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171010696 Original CRISPR CCTTCCACTCACCGCGAGAA AGG (reversed) Intergenic