ID: 1171010699

View in Genome Browser
Species Human (GRCh38)
Location 20:21507913-21507935
Sequence TCTCGCGGTGAGTGGAAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171010694_1171010699 -9 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data
1171010691_1171010699 -2 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data
1171010692_1171010699 -3 Left 1171010692 20:21507893-21507915 CCTTGGCCTCTCAGAACCTTTCT No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data
1171010688_1171010699 15 Left 1171010688 20:21507875-21507897 CCCGGGACTGAGCGGCACCCTTG No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data
1171010686_1171010699 30 Left 1171010686 20:21507860-21507882 CCAAGTCTAGCTGGGCCCGGGAC No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data
1171010689_1171010699 14 Left 1171010689 20:21507876-21507898 CCGGGACTGAGCGGCACCCTTGG No data
Right 1171010699 20:21507913-21507935 TCTCGCGGTGAGTGGAAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171010699 Original CRISPR TCTCGCGGTGAGTGGAAGGG CGG Intergenic