ID: 1171010702 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:21507934-21507956 |
Sequence | GGCTCCGCGCGCGGGCGCTT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171010691_1171010702 | 19 | Left | 1171010691 | 20:21507892-21507914 | CCCTTGGCCTCTCAGAACCTTTC | No data | ||
Right | 1171010702 | 20:21507934-21507956 | GGCTCCGCGCGCGGGCGCTTCGG | No data | ||||
1171010696_1171010702 | 2 | Left | 1171010696 | 20:21507909-21507931 | CCTTTCTCGCGGTGAGTGGAAGG | No data | ||
Right | 1171010702 | 20:21507934-21507956 | GGCTCCGCGCGCGGGCGCTTCGG | No data | ||||
1171010694_1171010702 | 12 | Left | 1171010694 | 20:21507899-21507921 | CCTCTCAGAACCTTTCTCGCGGT | No data | ||
Right | 1171010702 | 20:21507934-21507956 | GGCTCCGCGCGCGGGCGCTTCGG | No data | ||||
1171010692_1171010702 | 18 | Left | 1171010692 | 20:21507893-21507915 | CCTTGGCCTCTCAGAACCTTTCT | No data | ||
Right | 1171010702 | 20:21507934-21507956 | GGCTCCGCGCGCGGGCGCTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171010702 | Original CRISPR | GGCTCCGCGCGCGGGCGCTT CGG | Intergenic | ||