ID: 1171010704 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:21507936-21507958 |
Sequence | CTCCGCGCGCGGGCGCTTCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171010691_1171010704 | 21 | Left | 1171010691 | 20:21507892-21507914 | CCCTTGGCCTCTCAGAACCTTTC | No data | ||
Right | 1171010704 | 20:21507936-21507958 | CTCCGCGCGCGGGCGCTTCGGGG | No data | ||||
1171010696_1171010704 | 4 | Left | 1171010696 | 20:21507909-21507931 | CCTTTCTCGCGGTGAGTGGAAGG | No data | ||
Right | 1171010704 | 20:21507936-21507958 | CTCCGCGCGCGGGCGCTTCGGGG | No data | ||||
1171010692_1171010704 | 20 | Left | 1171010692 | 20:21507893-21507915 | CCTTGGCCTCTCAGAACCTTTCT | No data | ||
Right | 1171010704 | 20:21507936-21507958 | CTCCGCGCGCGGGCGCTTCGGGG | No data | ||||
1171010694_1171010704 | 14 | Left | 1171010694 | 20:21507899-21507921 | CCTCTCAGAACCTTTCTCGCGGT | No data | ||
Right | 1171010704 | 20:21507936-21507958 | CTCCGCGCGCGGGCGCTTCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171010704 | Original CRISPR | CTCCGCGCGCGGGCGCTTCG GGG | Intergenic | ||