ID: 1171010706

View in Genome Browser
Species Human (GRCh38)
Location 20:21507940-21507962
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171010691_1171010706 25 Left 1171010691 20:21507892-21507914 CCCTTGGCCTCTCAGAACCTTTC No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data
1171010692_1171010706 24 Left 1171010692 20:21507893-21507915 CCTTGGCCTCTCAGAACCTTTCT No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data
1171010694_1171010706 18 Left 1171010694 20:21507899-21507921 CCTCTCAGAACCTTTCTCGCGGT No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data
1171010696_1171010706 8 Left 1171010696 20:21507909-21507931 CCTTTCTCGCGGTGAGTGGAAGG No data
Right 1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171010706 Original CRISPR GCGCGCGGGCGCTTCGGGGC CGG Intergenic
No off target data available for this crispr