ID: 1171013635

View in Genome Browser
Species Human (GRCh38)
Location 20:21521962-21521984
Sequence GAGGGGCGCGGCACCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171013635_1171013652 21 Left 1171013635 20:21521962-21521984 CCGCCGCGGGTGCCGCGCCCCTC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013635_1171013650 20 Left 1171013635 20:21521962-21521984 CCGCCGCGGGTGCCGCGCCCCTC No data
Right 1171013650 20:21522005-21522027 CCCCGCACCTTCCCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171013635 Original CRISPR GAGGGGCGCGGCACCCGCGG CGG (reversed) Intergenic
No off target data available for this crispr