ID: 1171013636

View in Genome Browser
Species Human (GRCh38)
Location 20:21521965-21521987
Sequence AGGGAGGGGCGCGGCACCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171013636_1171013652 18 Left 1171013636 20:21521965-21521987 CCGCGGGTGCCGCGCCCCTCCCT No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013636_1171013650 17 Left 1171013636 20:21521965-21521987 CCGCGGGTGCCGCGCCCCTCCCT No data
Right 1171013650 20:21522005-21522027 CCCCGCACCTTCCCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171013636 Original CRISPR AGGGAGGGGCGCGGCACCCG CGG (reversed) Intergenic