ID: 1171013652

View in Genome Browser
Species Human (GRCh38)
Location 20:21522006-21522028
Sequence CCCGCACCTTCCCAGCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171013641_1171013652 -1 Left 1171013641 20:21521984-21522006 CCCTCCTCCTCCGCCTCCCAGCC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013635_1171013652 21 Left 1171013635 20:21521962-21521984 CCGCCGCGGGTGCCGCGCCCCTC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013636_1171013652 18 Left 1171013636 20:21521965-21521987 CCGCGGGTGCCGCGCCCCTCCCT No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013643_1171013652 -5 Left 1171013643 20:21521988-21522010 CCTCCTCCGCCTCCCAGCCCCGC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013642_1171013652 -2 Left 1171013642 20:21521985-21522007 CCTCCTCCTCCGCCTCCCAGCCC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013644_1171013652 -8 Left 1171013644 20:21521991-21522013 CCTCCGCCTCCCAGCCCCGCACC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013639_1171013652 3 Left 1171013639 20:21521980-21522002 CCCTCCCTCCTCCTCCGCCTCCC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013637_1171013652 9 Left 1171013637 20:21521974-21521996 CCGCGCCCCTCCCTCCTCCTCCG No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013638_1171013652 4 Left 1171013638 20:21521979-21522001 CCCCTCCCTCCTCCTCCGCCTCC No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
1171013640_1171013652 2 Left 1171013640 20:21521981-21522003 CCTCCCTCCTCCTCCGCCTCCCA No data
Right 1171013652 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171013652 Original CRISPR CCCGCACCTTCCCAGCCCCT GGG Intergenic
No off target data available for this crispr