ID: 1171013661

View in Genome Browser
Species Human (GRCh38)
Location 20:21522034-21522056
Sequence CCCGCTTTCCCTGACCGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171013645_1171013661 17 Left 1171013645 20:21521994-21522016 CCGCCTCCCAGCCCCGCACCTTC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013657_1171013661 -10 Left 1171013657 20:21522021-21522043 CCCCTGGGACAGTCCCGCTTTCC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013648_1171013661 10 Left 1171013648 20:21522001-21522023 CCAGCCCCGCACCTTCCCAGCCC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013653_1171013661 4 Left 1171013653 20:21522007-21522029 CCGCACCTTCCCAGCCCCTGGGA No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013647_1171013661 11 Left 1171013647 20:21522000-21522022 CCCAGCCCCGCACCTTCCCAGCC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013651_1171013661 5 Left 1171013651 20:21522006-21522028 CCCGCACCTTCCCAGCCCCTGGG No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013643_1171013661 23 Left 1171013643 20:21521988-21522010 CCTCCTCCGCCTCCCAGCCCCGC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013640_1171013661 30 Left 1171013640 20:21521981-21522003 CCTCCCTCCTCCTCCGCCTCCCA No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013646_1171013661 14 Left 1171013646 20:21521997-21522019 CCTCCCAGCCCCGCACCTTCCCA No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013642_1171013661 26 Left 1171013642 20:21521985-21522007 CCTCCTCCTCCGCCTCCCAGCCC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013656_1171013661 -6 Left 1171013656 20:21522017-21522039 CCAGCCCCTGGGACAGTCCCGCT No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013649_1171013661 6 Left 1171013649 20:21522005-21522027 CCCCGCACCTTCCCAGCCCCTGG No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013654_1171013661 -1 Left 1171013654 20:21522012-21522034 CCTTCCCAGCCCCTGGGACAGTC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013655_1171013661 -5 Left 1171013655 20:21522016-21522038 CCCAGCCCCTGGGACAGTCCCGC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013641_1171013661 27 Left 1171013641 20:21521984-21522006 CCCTCCTCCTCCGCCTCCCAGCC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data
1171013644_1171013661 20 Left 1171013644 20:21521991-21522013 CCTCCGCCTCCCAGCCCCGCACC No data
Right 1171013661 20:21522034-21522056 CCCGCTTTCCCTGACCGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171013661 Original CRISPR CCCGCTTTCCCTGACCGCAC CGG Intergenic