ID: 1171015093

View in Genome Browser
Species Human (GRCh38)
Location 20:21533443-21533465
Sequence GTTTTCCAGAATCCAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171015087_1171015093 19 Left 1171015087 20:21533401-21533423 CCAACTCTGAGGTGCAGTGGCAG No data
Right 1171015093 20:21533443-21533465 GTTTTCCAGAATCCAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171015093 Original CRISPR GTTTTCCAGAATCCAAAGAA GGG Intergenic
No off target data available for this crispr